DNASU Plasmid Repository • 480.965.5697 | Email

CA5A (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CA5A
Gene Name:  carbonic anhydrase VA, mitochondrial
Sequence             
Original Clone ID: ccsbBroadEn_05921
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC137405.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00515510

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 916nts         Open reading frame : 1 to 916
Reference Sequence Alignment

ATGTTGGGGAGGAACACTTGGAAGACCTCAGCTTTCTCCTTCTTGGTTGAGCAGATGTGG
GCCCCTCTCTGGAGTCGTTCGATGAGGCCAGGGCGATGGTGTTCTCAGCGTTCCTGTGCA
TGGCAAACCAGCAATAACACTTTGCACCCACTCTGGACGGTCCCGGTCTCCGTGCCAGGG
GGCACCCGGCAGTCTCCTATTAACATCCAGTGGAGGGACAGCGTCTATGACCCCCAGCTG
AAGCCACTCAGGGTCTCCTATGAAGCGGCATCCTGCCTGTACATCTGGAACACTGGCTAC
CTCTTCCAGGTGGAATTTGACGATGCCACCGAGGCATCAGGAATTAGTGGTGGGCCCTTG
GAAAACCACTACAGACTGAAGCAATTTCACTTCCACTGGGGAGCAGTGAACGAGGGGGGC
TCAGAGCACACAGTGGACGGCCACGCGTACCCTGCAGAGCTGCATTTAGTTCACTGGAAT
TCTGTGAAATACCAAAATTACAAGGAAGCTGTCGTGGGAGAGAATGGTTTGGCTGTGATA
GGCGTGTTTTTAAAGCTCGGGGCCCATCATCAGACGCTGCAGAGGCTGGTGGACATCTTG
CCGGAAATAAAACATAAGGACGCGCGGGCGGCCATGCGCCCCTTCGACCCCTCCACTCTG
CTGCCCACCTGCTGGGATTACTGGACCTACGCGGGCTCGCTCACCACCCCGCCGCTGACC
GAGTCGGTCACCTGGATCATCCAGAAGGAGCCCGTTGAAGTGGCCCCAAGCCAGCTCTCT
GCATTTCGTACTCTCCTGTTTTCTGCTCTTGGTGAAGAGGAGAAGATGATGGTGAACAAC
TATCGCCCACTTCAACCCTTGATGAACCGGAAGGTCTGGGCGTCCTTCCAGGCCACTAAT
GAGGGCACAAGGTCC


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CA5A
Symbol Nomenclature : CA5A
SYNONYM : CA5; CAV; CAVA
Designation : CA-VA|carbonate dehydratase VA|carbonic anhydrase 5A, mitochondrial|carbonic anhydrase V, mitochondrial|carbonic dehydratase
Full Nomenclature : carbonic anhydrase VA, mitochondrial
GENEID : 763
HGNC : 1377
MIM : 114761
Vega : OTTHUMG00000137677
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00515510      ATGTTGGGGAGGAACACTTGGAAGACCTCAGCTTTCTCCTTCTTGGTTGAGCAGATGTGG
NM_001739.1       ATGTTGGGGAGGAACACTTGGAAGACCTCAGCTTTCTCCTTCTTGGTTGAGCAGATGTGG
                  ************************************************************

HsCD00515510      GCCCCTCTCTGGAGTCGTTCGATGAGGCCAGGGCGATGGTGTTCTCAGCGTTCCTGTGCA
NM_001739.1       GCCCCTCTCTGGAGTCGTTCGATGAGGCCAGGGCGATGGTGTTCTCAGCGTTCCTGTGCA
                  ************************************************************

HsCD00515510      TGGCAAACCAGCAATAACACTTTGCACCCACTCTGGACGGTCCCGGTCTCCGTGCCAGGG
NM_001739.1       TGGCAAACCAGCAATAACACTTTGCACCCACTCTGGACGGTCCCGGTCTCCGTGCCAGGG
                  ************************************************************

HsCD00515510      GGCACCCGGCAGTCTCCTATTAACATCCAGTGGAGGGACAGCGTCTATGACCCCCAGCTG
NM_001739.1       GGCACCCGGCAGTCTCCTATTAACATCCAGTGGAGGGACAGCGTCTATGACCCCCAGCTG
                  ************************************************************

HsCD00515510      AAGCCACTCAGGGTCTCCTATGAAGCGGCATCCTGCCTGTACATCTGGAACACTGGCTAC
NM_001739.1       AAGCCACTCAGGGTCTCCTATGAAGCGGCATCCTGCCTGTACATCTGGAACACTGGCTAC
                  ************************************************************

HsCD00515510      CTCTTCCAGGTGGAATTTGACGATGCCACCGAGGCATCAGGAATTAGTGGTGGGCCCTTG
NM_001739.1       CTCTTCCAGGTGGAATTTGACGATGCCACCGAGGCATCAGGAATTAGTGGTGGGCCCTTG
                  ************************************************************

HsCD00515510      GAAAACCACTACAGACTGAAGCAATTTCACTTCCACTGGGGAGCAGTGAACGAGGGGGGC
NM_001739.1       GAAAACCACTACAGACTGAAGCAATTTCACTTCCACTGGGGAGCAGTGAACGAGGGGGGC
                  ************************************************************

HsCD00515510      TCAGAGCACACAGTGGACGGCCACGCGTACCCTGCAGAGCTGCATTTAGTTCACTGGAAT
NM_001739.1       TCAGAGCACACAGTGGACGGCCACGCGTACCCCGCAGAGCTGCATTTAGTTCACTGGAAT
                  ******************************** ***************************

HsCD00515510      TCTGTGAAATACCAAAATTACAAGGAAGCTGTCGTGGGAGAGAATGGTTTGGCTGTGATA
NM_001739.1       TCTGTGAAATACCAAAATTACAAGGAAGCTGTCGTGGGAGAGAATGGTTTGGCTGTGATA
                  ************************************************************

HsCD00515510      GGCGTGTTTTTAAAGCTCGGGGCCCATCATCAGACGCTGCAGAGGCTGGTGGACATCTTG
NM_001739.1       GGCGTGTTTTTAAAGCTCGGGGCCCATCATCAGACGCTGCAGAGGCTGGTGGACATCTTG
                  ************************************************************

HsCD00515510      CCGGAAATAAAACATAAGGACGCGCGGGCGGCCATGCGCCCCTTCGACCCCTCCACTCTG
NM_001739.1       CCGGAAATAAAACATAAGGACGCGCGGGCGGCCATGCGCCCCTTCGACCCCTCCACTCTG
                  ************************************************************

HsCD00515510      CTGCCCACCTGCTGGGATTACTGGACCTACGCGGGCTCGCTCACCACCCCGCCGCTGACC
NM_001739.1       CTGCCCACCTGCTGGGATTACTGGACCTACGCGGGCTCGCTCACCACCCCGCCGCTGACC
                  ************************************************************

HsCD00515510      GAGTCGGTCACCTGGATCATCCAGAAGGAGCCCGTTGAAGTGGCCCCAAGCCAGCTCTCT
NM_001739.1       GAGTCGGTCACCTGGATCATCCAGAAGGAGCCCGTTGAAGTGGCCCCAAGCCAGCTCTCT
                  ************************************************************

HsCD00515510      GCATTTCGTACTCTCCTGTTTTCTGCTCTTGGTGAAGAGGAGAAGATGATGGTGAACAAC
NM_001739.1       GCATTTCGTACTCTCCTGTTTTCTGCACTTGGTGAAGAGGAGAAGATGATGGTGAACAAC
                  **************************:*********************************

HsCD00515510      TATCGCCCACTTCAACCCTTGATGAACCGGAAGGTCTGGGCGTCCTTCCAGGCCACTAAT
NM_001739.1       TATCGCCCACTTCAACCCTTGATGAACCGGAAGGTCTGGGCGTCCTTCCAGGCCACTAAT
                  ************************************************************

HsCD00515510      GAGGGCACAAGGTCC---
NM_001739.1       GAGGGCACAAGGTCCTAG
                  ***************   

Pathways

Reactome : Metabolism
Reactome : Reversible hydration of carbon dioxide

Protein

SMART domain : Carb_anhydrase : Eukaryotic-type carbonic anhydrase
HPRD : 00262

Clone

Cloning Information : 668316
Original Clone ID : ccsbBroadEn_05921

Organism


TAX_ID : 9606
Species Specific ID: 763

Genome

Chromosome : 16
Map Location : 16q24.3
Ensembl : ENSG00000174990

Reagents

Labome : CA5A-antibody