DNASU Plasmid Repository • 480.965.5697 | Email

PPP3CB (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPP3CB
Gene Name:  protein phosphatase 3, catalytic subunit, beta isozyme
Sequence             
Original Clone ID: ccsbBroadEn_01268
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC028049.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00515899

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1576nts         Open reading frame : 1 to 1576
Reference Sequence Alignment

ATGGCCGCCCCGGAGCCGGCCCGGGCTGCACCGCCCCCACCCCCGCCCCCGCCGCCCCCT
CCCGGGGCTGACCGCGTCGTCAAAGCTGTCCCTTTCCCCCCAACACATCGCTTGACATCT
GAAGAAGTATTTGATTTGGATGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTG
AAAGAAGGTCGAGTAGATGAAGAAATTGCGCTTAGAATTATCAATGAGGGTGCTGCCATC
CTTCGGAGAGAGAAAACCATGATAGAAGTAGAAGCTCCAATCACAGTGTGTGGTGACATC
CATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACCTGCTAATACA
CGATACCTTTTTCTTGGCGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTA
TATTTATGGGTTCTGAAGATTCTATACCCAAGCACATTATTTCTTCTGAGAGGCAACCAT
GAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAGTATTCG
GAAAGAGTCTATGAAGCTTGTATGGAAGCTTTTGATAGTTTGCCTCTTGCTGCACTTTTA
AACCAACAGTTTCTTTGTGTTCATGGTGGACTTTCACCAGAAATACACACACTGGATGAT
ATTAGGAGATTAGATAGATTCAAAGAGCCACCTGCATTTGGACCAATGTGTGACTTGTTA
TGGTCCGATCCTTCTGAAGATTTTGGAAATGAAAAATCACAGGAACATTTTAGTCACAAT
ACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAAC
AATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTAC
AGAAAAAGTCAAACTACAGGGTTCCCTTCATTAATAACAATTTTTTCGGCACCTAATTAC
TTAGATGTCTACAATAATAAAGCTGCTGTATTAAAGTATGAAAATAATGTGATGAATATT
CGACAGTTTAACTGTTCTCCACATCCTTACTGGTTGCCTAATTTTATGGATGTCTTCACG
TGGTCTTTACCGTTTGTTGGAGAAAAAGTGACAGAAATGTTGGTAAATGTTCTGAGTATT
TGCTCTGATGATGAACTAATGACTGAAGGTGAAGACCAGTTTGATGTAGGTTCAGCTGCA
GCCCGGAAAGAAATCATAAGAAACAAAATTCGAGCAATTGGCAAGATGGCAAGAGTCTTC
TCTGTTCTCAGGGAGGAGAGTGAAAGTGTGCTGACACTCAAGGGCCTGACTCCCACAGGG
ATGTTGCCTAGTGGAGTGTTAGCTGGAGGACGGCAGACCCTGCAAAGTGCCACAGTTGAG
GCTATTGAGGCTGAAAAAGCAATACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTT
GAAGAGGCAAAGGGTTTGGATAGGATCAATGAGAGAATGCCACCTCGGAAAGATGCTGTA
CAGCAAGATGGTTTCAATTCTCTGAACACCGCACATGCCACTGAGAACCACGGGACGGGC
AACCATACTGCCCAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPP3CB
Symbol Nomenclature : PPP3CB
SYNONYM : CALNA2; CALNB; CNA2; PP2Bbeta
Designation : CAM-PRP catalytic subunit|calcineurin A beta|calcineurin A2|calmodulin-dependent calcineurin A subunit beta isoform|protein phosphatase 2B, catalytic subunit, beta isoform|protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform|protein phosphatase from PCR fragment H32|serine/threonine-protein phosphatase 2B catalytic subunit beta isoform
Full Nomenclature : protein phosphatase 3, catalytic subunit, beta isozyme
GENEID : 5532
Locus Tag : RP11-345K20.1
HGNC : 9315
MIM : 114106
Vega : OTTHUMG00000018472
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00515899        ATGGCCGCCCCGGAGCCGGCCCGGGCTGCACCGCCCCCACCCCCGCCCCCGCCGCCCCCT
XM_005269944.1      ATGGCCGCCCCGGAGCCGGCCCGGGCTGCACCGCCCCCACCCCCGCCCCCGCCGCCCCCT
                    ************************************************************

HsCD00515899        CCCGGGGCTGACCGCGTCGTCAAAGCTGTCCCTTTCCCCCCAACACATCGCTTGACATCT
XM_005269944.1      CCCGGGGCTGACCGCGTCGTCAAAGCTGTCCCTTTCCCCCCAACACATCGCTTGACATCT
                    ************************************************************

HsCD00515899        GAAGAAGTATTTGATTTGGATGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTG
XM_005269944.1      GAAGAAGTATTTGATTTGGATGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTG
                    ************************************************************

HsCD00515899        AAAGAAGGTCGAGTAGATGAAGAAATTGCGCTTAGAATTATCAATGAGGGTGCTGCCATC
XM_005269944.1      AAAGAAGGTCGAGTAGATGAAGAAATTGCGCTTAGAATTATCAATGAGGGTGCTGCCATC
                    ************************************************************

HsCD00515899        CTTCGGAGAGAGAAAACCATGATAGAAGTAGAAGCTCCAATCACAGTGTGTGGTGACATC
XM_005269944.1      CTTCGGAGAGAGAAAACCATGATAGAAGTAGAAGCTCCAATCACAGTGTGTGGTGACATC
                    ************************************************************

HsCD00515899        CATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACCTGCTAATACA
XM_005269944.1      CATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACCTGCTAATACA
                    ************************************************************

HsCD00515899        CGATACCTTTTTCTTGGCGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTA
XM_005269944.1      CGATACCTTTTTCTTGGCGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTA
                    ************************************************************

HsCD00515899        TATTTATGGGTTCTGAAGATTCTATACCCAAGCACATTATTTCTTCTGAGAGGCAACCAT
XM_005269944.1      TATTTATGGGTTCTGAAGATTCTATACCCAAGCACATTATTTCTTCTGAGAGGCAACCAT
                    ************************************************************

HsCD00515899        GAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAGTATTCG
XM_005269944.1      GAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAGTATTCG
                    ************************************************************

HsCD00515899        GAAAGAGTCTATGAAGCTTGTATGGAAGCTTTTGATAGTTTGCCTCTTGCTGCACTTTTA
XM_005269944.1      GAAAGAGTCTATGAAGCTTGTATGGAAGCTTTTGATAGTTTGCCTCTTGCTGCACTTTTA
                    ************************************************************

HsCD00515899        AACCAACAGTTTCTTTGTGTTCATGGTGGACTTTCACCAGAAATACACACACTGGATGAT
XM_005269944.1      AACCAACAGTTTCTTTGTGTTCATGGTGGACTTTCACCAGAAATACACACACTGGATGAT
                    ************************************************************

HsCD00515899        ATTAGGAGATTAGATAGATTCAAAGAGCCACCTGCATTTGGACCAATGTGTGACTTGTTA
XM_005269944.1      ATTAGGAGATTAGATAGATTCAAAGAGCCACCTGCATTTGGACCAATGTGTGACTTGTTA
                    ************************************************************

HsCD00515899        TGGTCCGATCCTTCTGAAGATTTTGGAAATGAAAAATCACAGGAACATTTTAGTCACAAT
XM_005269944.1      TGGTCCGATCCTTCTGAAGATTTTGGAAATGAAAAATCACAGGAACATTTTAGTCACAAT
                    ************************************************************

HsCD00515899        ACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAAC
XM_005269944.1      ACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAAC
                    ************************************************************

HsCD00515899        AATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTAC
XM_005269944.1      AATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTAC
                    ************************************************************

HsCD00515899        AGAAAAAGTCAAACTACAGGGTTCCCTTCATTAATAACAATTTTTTCGGCACCTAATTAC
XM_005269944.1      AGAAAAAGTCAAACTACAGGGTTCCCTTCATTAATAACAATTTTTTCGGCACCTAATTAC
                    ************************************************************

HsCD00515899        TTAGATGTCTACAATAATAAAGCTGCTGTATTAAAGTATGAAAATAATGTGATGAATATT
XM_005269944.1      TTAGATGTCTACAATAATAAAGCTGCTGTATTAAAGTATGAAAATAATGTGATGAATATT
                    ************************************************************

HsCD00515899        CGACAGTTTAACTGTTCTCCACATCCTTACTGGTTGCCTAATTTTATGGATGTCTTCACG
XM_005269944.1      CGACAGTTTAACTGTTCTCCACATCCTTACTGGTTGCCTAATTTTATGGATGTCTTCACG
                    ************************************************************

HsCD00515899        TGGTCTTTACCGTTTGTTGGAGAAAAAGTGACAGAAATGTTGGTAAATGTTCTGAGTATT
XM_005269944.1      TGGTCTTTACCGTTTGTTGGAGAAAAAGTGACAGAAATGTTGGTAAATGTTCTGAGTATT
                    ************************************************************

HsCD00515899        TGCTCTGATGATGAACTAATGACTGAAGGTGAAGACCAGTTTGATGTAGGTTCAGCTGCA
XM_005269944.1      TGCTCTGATGATGAACTAATGACTGAAGGTGAAGACCAGTTTGATG---GTTCAGCTGCA
                    **********************************************   ***********

HsCD00515899        GCCCGGAAAGAAATCATAAGAAACAAAATTCGAGCAATTGGCAAGATGGCAAGAGTCTTC
XM_005269944.1      GCCCGGAAAGAAATCATAAGAAACAAAATTCGAGCAATTGGCAAGATGGCAAGAGTCTTC
                    ************************************************************

HsCD00515899        TCTGTTCTCAGGGAGGAGAGTGAAAGTGTGCTGACACTCAAGGGCCTGACTCCCACAGGG
XM_005269944.1      TCTGTTCTCAGGGAGGAGAGTGAAAGTGTGCTGACACTCAAGGGCCTGACTCCCACAGGG
                    ************************************************************

HsCD00515899        ATGTTGCCTAGTGGAGTGTTAGCTGGAGGACGGCAGACCCTGCAAAGTGCCACAGTTGAG
XM_005269944.1      ATGTTGCCTAGTGGAGTGTTAGCTGGAGGACGGCAGACCCTGCAAAGT------------
                    ************************************************            

HsCD00515899        GCTATTGAGGCTGAAAAAGCAATACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTT
XM_005269944.1      ------------------GCAATACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTT
                                      ******************************************

HsCD00515899        GAAGAGGCAAAGGGTTTGGATAGGATCAATGAGAGAATGCCACCTCGGAAAGATGCTGTA
XM_005269944.1      GAAGAGGCAAAGGGTTTGGATAGGATCAATGAGAGAATGCCACCTCGGAAAGATGCTGTA
                    ************************************************************

HsCD00515899        CAGCAAGATGGTTTCAATTCTCTGAACACCGCACATGCCACTGAGAACCACGGGACGGGC
XM_005269944.1      CAGCAAGATGGTTTCAATTCTCTGAACACCGCACATGCCACTGAGAACCACGGGACGGGC
                    ************************************************************

HsCD00515899        AACCATACTGCCCAG---
XM_005269944.1      AACCATACTGCCCAGTGA
                    ***************   

Pathways

NCI : BCR signaling pathway
NCI : Calcium signaling in the CD4+ TCR pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : ErbB2/ErbB3 signaling events
NCI : IL12 signaling mediated by STAT4
NCI : IL12-mediated signaling events
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
Panther : B cell activation
Panther : T cell activation
Panther : Wnt signaling pathway
Reactome : Ca2+ pathway
Reactome : DARPP-32 events
Reactome : FCERI mediated Ca+2 mobilization
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Opioid Signalling
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : beta-catenin independent WNT signaling
WikiPathway : Alzheimers Disease
WikiPathway : Energy Metabolism
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Physiological and Pathological Hypertrophy of the Heart

Clone

Cloning Information : 669845
Original Clone ID : ccsbBroadEn_01268

Organism


TAX_ID : 9606
Species Specific ID: 5532

Genome

Chromosome : 10
Map Location : 10q22.2
Ensembl : ENSG00000107758

Reagents

Labome : PPP3CB-antibody