DNASU Plasmid Repository • 480.965.5697 | Email

NPAS2 (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NPAS2
Gene Name:  neuronal PAS domain protein 2
Sequence             
Original Clone ID: ccsbBroadEn_06653
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC051351.1
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00516314

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2473nts         Open reading frame : 1 to 2473
Reference Sequence Alignment

ATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAACAAGTCTGAGAAGAAG
CGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATGCTCCCTGGCAACACG
CGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTTTTGCAGAAACACAAT
GAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGGAAGCCTTCATTCCTC
AGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGCTTCATTATCGCAGTG
ACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCTCTCCTTGGGCATTTA
CCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAACAAGAACATTCAGAA
GTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCCTCCCCAGAATACTTA
AAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGCAGTTTGAACCCAAAG
GAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGCTCTTACAACAATGTG
CCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCTTGCCGGGTGCCACTA
GGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCACAATTCTTAAAGGAA
ATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCATAGCTTGGAATGGAAA
TTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTGCCTTTTGAAGTGCTG
GGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTCCTGGCCAGGTGTCAC
CAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGGTTTCTGACCAAAGGT
CAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCATCAGTGGAACTCCAAG
CCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGATGTCCGGGTGGAAAGG
AGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCACTCCTCAGCACTAAAG
GACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACGCACTCGACGTGGGTGCCTCG
GGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCCCACAAATCCTCGCAC
ACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCAGAGGCCAGCACCCCG
GCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCCGGGCTCAGCCAGGCA
GCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTCACACAGCAGCTCCTG
CCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTTTCGGCACAGTTCAGC
ATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATCCTGCAGGCCAATATC
CGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGCCTGGTCCAGGACTCC
AACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTCAGCAGCACCCAGCGA
CCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACTCAGCCCCAGCTCGGG
GCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACAAGCCAGCACCTGCTC
AGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGAAGCTCACAGCTAATG
CAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGCAGCGCCACAGCTGCG
CTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAGGATGCCAGCCAGTGC
CAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTGCTGAGCCAGCCCATC
CAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAAGTCAGCAGGACGGGA
CGGCAAGTCAAGTACGCCCAGAGCCAGACTGTGTTTCAAAATCCAGACGCACACCCCGCC
AACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCGGTGCTCCACCCCAGC
TTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGGCAGCAGCCACCGCAG
CACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAGCAGGACTCGCTACTT
CTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAACCACCCCCAGCACAG
CCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAGTCGTCAGGCCTCCAG
CAGCCGCCCCGA


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
1 error
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NPAS2
Symbol Nomenclature : NPAS2
SYNONYM : MOP4; PASD4; bHLHe9
Designation : PAS domain-containing protein 4|basic-helix-loop-helix-PAS protein MOP4|class E basic helix-loop-helix protein 9|member of PAS protein 4|member of PAS superfamily 4|neuronal PAS domain-containing protein 2|neuronal PAS2
Full Nomenclature : neuronal PAS domain protein 2
GENEID : 4862
HGNC : 7895
MIM : 603347
Vega : OTTHUMG00000130675
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00516314        ------------------------------------------------------------
XM_005263959.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
XM_005263960.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
XM_005263953.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
XM_005263954.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
NM_002518.3         ------------------------------------------------------------
XM_005263957.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
                                                                                

HsCD00516314        ------------------------------------------------------------
XM_005263959.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
XM_005263960.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
XM_005263953.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
XM_005263954.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
NM_002518.3         ------------------------------------------------------------
XM_005263957.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
                                                                                

HsCD00516314        ------------------------------------------------------------
XM_005263959.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
XM_005263960.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
XM_005263953.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
XM_005263954.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
NM_002518.3         ------------------------------------------------------------
XM_005263957.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
                                                                                

HsCD00516314        ---------------ATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263959.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263960.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263953.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263954.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
NM_002518.3         ---------------ATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263957.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
                                   *********************************************

HsCD00516314        AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263959.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263960.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263953.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263954.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
NM_002518.3         AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263957.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
                    ************************************************************

HsCD00516314        CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263959.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263960.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263953.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263954.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
NM_002518.3         CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263957.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
                    ************************************************************

HsCD00516314        TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263959.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263960.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263953.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263954.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
NM_002518.3         TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263957.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
                    ************************************************************

HsCD00516314        AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263959.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263960.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263953.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263954.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
NM_002518.3         AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263957.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
                    ************************************************************

HsCD00516314        TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263959.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263960.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263953.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263954.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
NM_002518.3         TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263957.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
                    ************************************************************

HsCD00516314        CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263959.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263960.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263953.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263954.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
NM_002518.3         CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263957.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
                    ************************************************************

HsCD00516314        CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263959.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263960.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263953.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263954.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
NM_002518.3         CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263957.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
                    ************************************************************

HsCD00516314        TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263959.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263960.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAG--------------------------
XM_005263953.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263954.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
NM_002518.3         TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263957.1      TCCCCAGAATACTTAAAATTGCCTAGCCCCTCCTG-------------------------
                    *******************   . *** . * .                           

HsCD00516314        AGTTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263959.1      AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263954.1      AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
NM_002518.3         AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263957.1      ------------------------------------------------------------
                                                                                

HsCD00516314        TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263959.1      TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263954.1      TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
NM_002518.3         TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263957.1      -----------------------------TAATGGTTTTGACAACACCCTTTCAAGACCT
                                                                                

HsCD00516314        TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263959.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263954.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
NM_002518.3         TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263957.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
                                                                                

HsCD00516314        CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263959.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263960.1      -AGTTTTATTGCCATCTTCTCAGAGGCAGCTTGAACCCAAAGGAATTTCCAACTTATGAA
XM_005263953.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263954.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
NM_002518.3         CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263957.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
                     *.** *:::.  *:.*   ** **  ..* :...   *.******* .*::*::.  *:

HsCD00516314        AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263959.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263960.1      TACATAAAATTTGTAGGAAATTTTCG----------------------------------
XM_005263953.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263954.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
NM_002518.3         AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263957.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
                    :.*:*..***  .:*  ::::****                                   

HsCD00516314        CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263959.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263954.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
NM_002518.3         CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263957.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
                                                                                

HsCD00516314        CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263959.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263960.1      --------CTCTTACAACAATGTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263953.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263954.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
NM_002518.3         CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263957.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
                             * * **.* .*  **************************************

HsCD00516314        TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263959.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263960.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263953.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263954.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
NM_002518.3         TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263957.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
                    ************************************************************

HsCD00516314        CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263959.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263960.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263953.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263954.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
NM_002518.3         CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263957.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
                    ************************************************************

HsCD00516314        GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263959.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263960.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263953.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263954.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
NM_002518.3         GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263957.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
                    ************************************************************

HsCD00516314        TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACGCACTC
XM_005263959.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263960.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263953.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263954.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
NM_002518.3         TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263957.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
                    ******************************************************.*****

HsCD00516314        GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263959.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263960.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263953.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263954.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
NM_002518.3         GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263957.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
                    ************************************************************

HsCD00516314        CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263959.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263960.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263953.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263954.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
NM_002518.3         CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263957.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
                    ************************************************************

HsCD00516314        GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263959.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263960.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263953.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263954.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
NM_002518.3         GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263957.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
                    ************************************************************

HsCD00516314        GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263959.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263960.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263953.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263954.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
NM_002518.3         GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263957.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
                    ************************************************************

HsCD00516314        ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263959.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263960.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263953.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263954.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
NM_002518.3         ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263957.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
                    ************************************************************

HsCD00516314        TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263959.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263960.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263953.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263954.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
NM_002518.3         TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263957.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
                    ************************************************************

HsCD00516314        CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263959.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263960.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263953.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263954.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
NM_002518.3         CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263957.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
                    ************************************************************

HsCD00516314        CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263959.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263960.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263953.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263954.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
NM_002518.3         CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263957.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
                    ************************************************************

HsCD00516314        AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263959.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263960.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263953.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263954.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
NM_002518.3         AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263957.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
                    ************************************************************

HsCD00516314        CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263959.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263960.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263953.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263954.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
NM_002518.3         CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263957.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
                    ************************************************************

HsCD00516314        AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263959.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263960.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263953.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263954.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
NM_002518.3         AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263957.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
                    ************************************************************

HsCD00516314        AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263959.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263960.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263953.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263954.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
NM_002518.3         AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263957.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
                    ************************************************************

HsCD00516314        AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263959.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263960.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263953.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263954.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
NM_002518.3         AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263957.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
                    ************************************************************

HsCD00516314        GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263959.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263960.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263953.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263954.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
NM_002518.3         GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263957.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
                    ************************************************************

HsCD00516314        CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263959.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263960.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263953.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263954.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
NM_002518.3         CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263957.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
                    ************************************************************

HsCD00516314        GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACTGTGTTTCAAAATCCA
XM_005263959.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263960.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263953.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263954.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
NM_002518.3         GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263957.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
                    ******************************************** ***************

HsCD00516314        GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263959.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263960.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263953.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263954.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
NM_002518.3         GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263957.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
                    ************************************************************

HsCD00516314        GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263959.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263960.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263953.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263954.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
NM_002518.3         GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263957.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
                    ************************************************************

HsCD00516314        CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263959.1      CAGCAGCCACCGCAGCACTACCTGCAGGTTCTTGGGCACACTCTATAG------------
XM_005263960.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263953.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263954.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTTCTTGG
NM_002518.3         CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263957.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
                    *****************************:*: * .*..**   :*:*            

HsCD00516314        CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263959.1      ------------------------------------------------------------
XM_005263960.1      CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263953.1      CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263954.1      GCACACTCTATAGCCATACTGGACAGGAACCAGGTGCCCCGTGTAGGCATCGTCGGTCGG
NM_002518.3         CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263957.1      CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
                                                                                

HsCD00516314        CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263959.1      ------------------------------------------------------------
XM_005263960.1      CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263953.1      CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263954.1      TTTGCCGTCAGAGATGGCGCATCTCGCTGCATCCCCCGAGAGTACACCGGTTGCTCTAGC
NM_002518.3         CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263957.1      CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
                                                                                

HsCD00516314        TCGTCAGGCCTCCAGCAGCCGCCCCGA---
XM_005263959.1      ------------------------------
XM_005263960.1      TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
XM_005263953.1      TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
XM_005263954.1      CACCTGCGGCCCGCCCATCTGCGCTAG---
NM_002518.3         TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
XM_005263957.1      TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
                                                  

Pathways

NCI : Circadian rhythm pathway
Reactome : BMAL1:CLOCK,NPAS2 activates circadian gene expression
Reactome : Circadian Clock
Reactome : Fatty acid, triacylglycerol, and ketone body metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PPARA activates gene expression
Reactome : REV-ERBA represses gene expression
Reactome : RORA activates circadian gene expression
Reactome : Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha)

Clone

Cloning Information : 666555
Original Clone ID : ccsbBroadEn_06653

Organism


TAX_ID : 9606
Species Specific ID: 4862

Genome

Chromosome : 2
Map Location : 2q11.2
Ensembl : ENSG00000170485

Reagents

Labome : NPAS2-antibody