DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CD (Homo sapiens) in pENTR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CD
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
Sequence             
Original Clone ID: ccsbBroadEn_01204
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pENTR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: Original GenBank Accession: BC132919.1
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
Dana-Farber Cancer Institute
Broad Institute of Harvard and Massachusetts Institute of Technology (MIT)
David E Hill
David E Root
Harvard Medical School
HsCD00516484

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3133nts         Open reading frame : 1 to 3133
Reference Sequence Alignment

ATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAGGAGAATCAGAGCGTT
GTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCTGTGTCCCGCAATGCC
AACCTCAGCACCATCAAGCAGCTGCTGTGGCACCGCGCCCAGTATGAGCCGCTCTTCCAC
ATGCTCAGTGGCCCCGAGGCCTATGTGTTCACCTGCATCAACCAGACAGCGGAGCAGCAA
GAGCTGGAGGACGAGCAACGGCGTCTGTGTGACGTGCAGCCCTTCCTGCCCGTCCTGCGC
CTGGTGGCCCGTGAGGGCGACCGCGTGAAGAAGCTCATCAACTCACAGATCAGCCTCCTC
ATCGGCAAAGGCCTCCACGAGTTTGACTCCTTGTGCGACCCAGAAGTGAACGACTTTCGC
GCCAAGATGTGCCAATTCTGCGAGGAGGCGGCCGCCCGCCGGCAGCAGCTGGGCTGGGAG
GCCTGGCTGCAGTACAGTTTCCCCCTGCAGCTGGAGCCCTCGGCTCAAACCTGGGGGCCT
GGTACCCTGCGGCTCCCGAACCGGGCCCTTCTGGTCAACGTTAAGTTTGAGGGCAGCGAG
GAGAGCTTCACCTTCCAGGTGTCCACCAAGGACGTGCCGCTGGCGCTGATGGCCTGTGCC
CTGCGGAAGAAGGCCACAGTGTTCCGGCAGCCGCTGGTGGAGCAGCCGGAAGACTACACG
CTGCAGGTGAACGGCAGGCATGAGTACCTGTATGGCAGCTACCCGCTCTGCCAGTTCCAG
TACATCTGCAGCTGCCTGCACAGTGGGTTGACCCCTCACCTGACCATGGTCCATTCCTCC
TCCATCCTCGCCATGCGGGATGAGCAGAGCAACCCTGCCCCCCAGGTCCAGAAACCGCGT
GCCAAACCACCTCCCATTCCTGCGAAGAAGCCTTCCTCTGTGTCCCTGTGGTCCCTGGAG
CAGCCGTTCCGCATCGAGCTCATCCAGGGCAGCAAAGTGAACGCCGACGAGCGGATGAAG
CTGGTGGTGCAGGCCGGGCTTTTCCACGGCAACGAGATGCTGTGCAAGACGGTGTCCAGC
TCGGAGGTGAGCGTGTGCTCGGAGCCCGTGTGGAAGCAGCGGCTGGAGTTCGACATCAAC
ATCTGCGACCTGCCCCGCATGGCCCGTCTCTGCTTTGCGCTGTACGCCGTGATCGAGAAA
GCCAAGAAGGCTCGCTCCACCAAGAAGAAGTCCAAGAAGGCGGACTGCCCCATTGCCTGG
GCCAACCTCATGCTGTTTGACTACAAGGACCAGCTTAAGACCGGGGAACGCTGCCTCTAC
ATGTGGCCCTCCGTCCCAGATGAGAAGGGCGAGCTGCTGAACCCCACGGGCACTGTGCGC
AGTAACCCCAACACGGATAGCGCCGCTGCCCTGCTCATCTGCCTGCCCGAGGTGGCCCCG
CACCCCGTGTACTACCCCGCCCTGGAGAAGATCTTGGAGCTGGGGCGACACAGCGAGTGT
GTGCATGTCACCGAGGAGGAGCAGCTGCAGCTGCGGGAAATCCTGGAGCGGCGGGGGTCT
GGGGAGCTGTATGAGCACGAGAAGGACCTGGTGTGGAAGCTGCGGCATGAAGTCCAGGAG
CACTTCCCGGAGGCGCTAGCCCGGCTGCTGCTGGTCACCAAGTGGAACAAGCATGAGGAT
GTGGCCCAGATGCTCTACCTGCTGTGCTCCTGGCCGGAGCTGCCCGTCCTGAGCGCCCTG
GAGCTGCTAGACTTCAGCTTCCCCGATTGCCACGTAGGCTCCTTCGCCATCAAGTCGCTG
CGGAAACTGACGGACGATGAGCTGTTCCAGTACCTGCTGCAGCTGGTGCAGGTGCTCAAG
TACGAGTCCTACCTGGACTGCGAGCTGACCAAATTCCTGCTGGACCGGGCCCTGGCCAAC
CGCAAGATCGGCCACTTCCTTTTCTGGCACCTCCGCTCCGAGATGCACGTGCCGTCGGTG
GCCCTGCGCTTCGGCCTCATCCTGGAGGCCTACTGCAGGGGCAGCACCCACCACATGAAG
GTGCTGATGAAGCAGGGGGAAGCACTGAGCAAACTGAAGGCCCTGAATGACTTCGTCAAG
CTGAGCTCTCAGAAGACCCCCAAGCCCCAGACCAAGGAGCTGATGCACTTGTGCATGCGG
CAGGAGGCCTACCTAGAGGCCCTCTCCCACCTGCAGTCCCCACTCGACCCCAGCACCCTG
CTGGCTGAAGTCTGCGTGGAGCAGTGCACCTTCATGGACTCCAAGATGAAGCCCCTGTGG
ATCATGTACAGCAACGAGGAGGCAGGCAGCGGCGGCAGCGTGGGCATCATCTTTAAGAAC
GGGGATGACCTCCGGCAGGACATGCTGACCCTGCAGATGATCCAGCTCATGGACGTCCTG
TGGAAGCAGGAGGGGCTGGACCTGAGGATGACCCCCTATGGCTGCCTCCCCACCGGGGAC
CGCACAGGCCTCATTGAGGTGGTACTCCGTTCAGACACCATCGCCAACATCCAACTCAAC
AAGAGCAACATGGCAGCCACAGCCGCCTTCAACAAGGATGCCCTGCTCAACTGGCTGAAG
TCCAAGAACCCGGGGGAGGCCCTGGATCGAGCCATTGAGGAGTTCACCCTCTCCTGTGCT
GGCTATTGTGTGGCCACATATGTGCTGGGCATTGGCGATCGGCACAGCGACAACATCATG
ATCCGAGAGAGTGGGCAGCTGTTCCACATTGATTTTGGCCACTTTCTGGGGAATTTCAAG
ACCAAGTTTGGAATCAACCGCGAGCGTGTCCCATTCATCCTCACCTACGACTTTGTCCAT
GTGATTCAGCAGGGGAAGACTAATAATAGTGAGAAATTTGAACGGTTCCGGGGCTACTGT
GAAAGGGCCTACACCATCCTGCGGCGCCACGGGCTTCTCTTCCTCCACCTCTTTGCCCTG
ATGCGGGCGGCAGGCCTGCCTGAGCTCAGCTGCTCCAAAGACATCCAGTATCTCAAGGAC
TCCCTGGCACTGGGGAAAACAGAGGAGGAGGCACTGAAGCACTTCCGAGTGAAGTTTAAC
GAAGCCCTCCGTGAGAGCTGGAAAACCAAAGTGAACTGGCTGGCCCACAACGTGTCCAAA
GACAACAGGCAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Verified by the ORFeome collaboration
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pENTR223

pENTR223 in advanced viewed

Synonyms: pDONR223, pENTR223-XnCDSYn
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Gateway type (lambda att-type) recombinational cloning entry (master) vector; spectinomycin resistance; recombinational cloning.
Comments: Additional information about this vector is available from the commercial website and at the ORFeome website http://orfeomecollaboration.org/vectors.php; also see supplemental figure 1 of the paper PubMed ID 15489335.
Size (bp): 2815
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Mark Vidal
Publications: PMID: 15489335
Title: Human ORFeome Version 1.1: A Platform for Reverse Proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 2220 2753
gene fragment pas 5p stem of pBR primose assembly site 63 73
gene fragment pas prime 3p stem of pBR pas(L) 105 116
recombination site attL1 attL1 recombination site 570 665
recombination site attL2 attL2 recombination site 793 696
selectable marker SpnR spectinomycin resistance gene 1062 2072
trxn termination sequence T1-T2 rrnBT1 and T2 terminators 510 224

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CD
Symbol Nomenclature : PIK3CD
SYNONYM : APDS; IMD14; P110DELTA; PI3K; p110D
Designation : PI3-kinase p110 subunit delta|PI3Kdelta|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit delta|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta isoform|phosphoinositide-3-kinase C|phosphoinositide-3-kinase, catalytic, delta polypeptide variant p37delta|ptdIns-3-kinase subunit p110-delta
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta
GENEID : 5293
Locus Tag : RP11-558F24.3
HGNC : 8977
MIM : 602839
Vega : OTTHUMG00000001450
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00516484        ATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAGGAGAATCAGAGCGTT
NM_005026.3         ATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAGGAGAATCAGAGCGTT
XM_005263473.1      ATGCCCCCTGGGGTGGACTGCCCCATGGAATTCTGGACCAAGGAGGAGAATCAGAGCGTT
                    ************************************************************

HsCD00516484        GTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCTGTGTCCCGCAATGCC
NM_005026.3         GTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCTGTGTCCCGCAATGCC
XM_005263473.1      GTGGTTGACTTCCTGCTGCCCACAGGGGTCTACCTGAACTTCCCTGTGTCCCGCAATGCC
                    ************************************************************

HsCD00516484        AACCTCAGCACCATCAAGCAGCTGCTGTGGCACCGCGCCCAGTATGAGCCGCTCTTCCAC
NM_005026.3         AACCTCAGCACCATCAAGCAGCTGCTGTGGCACCGCGCCCAGTATGAGCCGCTCTTCCAC
XM_005263473.1      AACCTCAGCACCATCAAGCAGCTGCTGTGGCACCGCGCCCAGTATGAGCCGCTCTTCCAC
                    ************************************************************

HsCD00516484        ATGCTCAGTGGCCCCGAGGCCTATGTGTTCACCTGCATCAACCAGACAGCGGAGCAGCAA
NM_005026.3         ATGCTCAGTGGCCCCGAGGCCTATGTGTTCACCTGCATCAACCAGACAGCGGAGCAGCAA
XM_005263473.1      ATGCTCAGTGGCCCCGAGGCCTATGTGTTCACCTGCATCAACCAGACAGCGGAGCAGCAA
                    ************************************************************

HsCD00516484        GAGCTGGAGGACGAGCAACGGCGTCTGTGTGACGTGCAGCCCTTCCTGCCCGTCCTGCGC
NM_005026.3         GAGCTGGAGGACGAGCAACGGCGTCTGTGTGACGTGCAGCCCTTCCTGCCCGTCCTGCGC
XM_005263473.1      GAGCTGGAGGACGAGCAACGGCGTCTGTGTGACGTGCAGCCCTTCCTGCCCGTCCTGCGC
                    ************************************************************

HsCD00516484        CTGGTGGCCCGTGAGGGCGACCGCGTGAAGAAGCTCATCAACTCACAGATCAGCCTCCTC
NM_005026.3         CTGGTGGCCCGTGAGGGCGACCGCGTGAAGAAGCTCATCAACTCACAGATCAGCCTCCTC
XM_005263473.1      CTGGTGGCCCGTGAGGGCGACCGCGTGAAGAAGCTCATCAACTCACAGATCAGCCTCCTC
                    ************************************************************

HsCD00516484        ATCGGCAAAGGCCTCCACGAGTTTGACTCCTTGTGCGACCCAGAAGTGAACGACTTTCGC
NM_005026.3         ATCGGCAAAGGCCTCCACGAGTTTGACTCCTTGTGCGACCCAGAAGTGAACGACTTTCGC
XM_005263473.1      ATCGGCAAAGGCCTCCACGAGTTTGACTCCTTGTGCGACCCAGAAGTGAACGACTTTCGC
                    ************************************************************

HsCD00516484        GCCAAGATGTGCCAATTCTGCGAGGAGGCGGCCGCCCGCCGGCAGCAGCTGGGCTGGGAG
NM_005026.3         GCCAAGATGTGCCAATTCTGCGAGGAGGCGGCCGCCCGCCGGCAGCAGCTGGGCTGGGAG
XM_005263473.1      GCCAAGATGTGCCAATTCTGCGAGGAGGCGGCCGCCCGCCGGCAGCAGCTGGGCTGGGAG
                    ************************************************************

HsCD00516484        GCCTGGCTGCAGTACAGTTTCCCCCTGCAGCTGGAGCCCTCGGCTCAAACCTGGGGGCCT
NM_005026.3         GCCTGGCTGCAGTACAGTTTCCCCCTGCAGCTGGAGCCCTCGGCTCAAACCTGGGGGCCT
XM_005263473.1      GCCTGGCTGCAGTACAGTTTCCCCCTGCAGCTGGAGCCCTCGGCTCAAACCTGGGGGCCT
                    ************************************************************

HsCD00516484        GGTACCCTGCGGCTCCCGAACCGGGCCCTTCTGGTCAACGTTAAGTTTGAGGGCAGCGAG
NM_005026.3         GGTACCCTGCGGCTCCCGAACCGGGCCCTTCTGGTCAACGTTAAGTTTGAGGGCAGCGAG
XM_005263473.1      GGTACCCTGCGGCTCCCGAACCGGGCCCTTCTGGTCAACGTTAAGTTTGAGGGCAGCGAG
                    ************************************************************

HsCD00516484        GAGAGCTTCACCTTCCAGGTGTCCACCAAGGACGTGCCGCTGGCGCTGATGGCCTGTGCC
NM_005026.3         GAGAGCTTCACCTTCCAGGTGTCCACCAAGGACGTGCCGCTGGCGCTGATGGCCTGTGCC
XM_005263473.1      GAGAGCTTCACCTTCCAGGTGTCCACCAAGGACGTGCCGCTGGCGCTGATGGCCTGTGCC
                    ************************************************************

HsCD00516484        CTGCGGAAGAAGGCCACAGTGTTCCGGCAGCCGCTGGTGGAGCAGCCGGAAGACTACACG
NM_005026.3         CTGCGGAAGAAGGCCACAGTGTTCCGGCAGCCGCTGGTGGAGCAGCCGGAAGACTACACG
XM_005263473.1      CTGCGGAAGAAGGCCACAGTGTTCCGGCAGCCGCTGGTGGAGCAGCCGGAAGACTACACG
                    ************************************************************

HsCD00516484        CTGCAGGTGAACGGCAGGCATGAGTACCTGTATGGCAGCTACCCGCTCTGCCAGTTCCAG
NM_005026.3         CTGCAGGTGAACGGCAGGCATGAGTACCTGTATGGCAGCTACCCGCTCTGCCAGTTCCAG
XM_005263473.1      CTGCAGGTGAACGGCAGGCATGAGTACCTGTATGGCAGCTACCCGCTCTGCCAGTTCCAG
                    ************************************************************

HsCD00516484        TACATCTGCAGCTGCCTGCACAGTGGGTTGACCCCTCACCTGACCATGGTCCATTCCTCC
NM_005026.3         TACATCTGCAGCTGCCTGCACAGTGGGTTGACCCCTCACCTGACCATGGTCCATTCCTCC
XM_005263473.1      TACATCTGCAGCTGCCTGCACAGTGGGTTGACCCCTCACCTGACCATGGTCCATTCCTCC
                    ************************************************************

HsCD00516484        TCCATCCTCGCCATGCGGGATGAGCAGAGCAACCCTGCCCCCCAGGTCCAGAAACCGCGT
NM_005026.3         TCCATCCTCGCCATGCGGGATGAGCAGAGCAACCCTGCCCCCCAGGTCCAGAAACCGCGT
XM_005263473.1      TCCATCCTCGCCATGCGGGATGAGCAGAGCAACCCTGCCCCCCAGGTCCAGAAACCGCGT
                    ************************************************************

HsCD00516484        GCCAAACCACCTCCCATTCCTGCGAAGAAGCCTTCCTCTGTGTCCCTGTGGTCCCTGGAG
NM_005026.3         GCCAAACCACCTCCCATTCCTGCGAAGAAGCCTTCCTCTGTGTCCCTGTGGTCCCTGGAG
XM_005263473.1      GCCAAACCACCTCCCATTCCTGCGAAGAAGCCTTCCTCTGTGTCCCTGTGGTCCCTGGAG
                    ************************************************************

HsCD00516484        CAGCCGTTCCGCATCGAGCTCATCCAGGGCAGCAAAGTGAACGCCGACGAGCGGATGAAG
NM_005026.3         CAGCCGTTCCGCATCGAGCTCATCCAGGGCAGCAAAGTGAACGCCGACGAGCGGATGAAG
XM_005263473.1      CAGCCGTTCCGCATCGAGCTCATCCAGGGCAGCAAAGTGAACGCCGACGAGCGGATGAAG
                    ************************************************************

HsCD00516484        CTGGTGGTGCAGGCCGGGCTTTTCCACGGCAACGAGATGCTGTGCAAGACGGTGTCCAGC
NM_005026.3         CTGGTGGTGCAGGCCGGGCTTTTCCACGGCAACGAGATGCTGTGCAAGACGGTGTCCAGC
XM_005263473.1      CTGGTGGTGCAGGCCGGGCTTTTCCACGGCAACGAGATGCTGTGCAAGACGGTGTCCAGC
                    ************************************************************

HsCD00516484        TCGGAGGTGAGCGTGTGCTCGGAGCCCGTGTGGAAGCAGCGGCTGGAGTTCGACATCAAC
NM_005026.3         TCGGAGGTGAGCGTGTGCTCGGAGCCCGTGTGGAAGCAGCGGCTGGAGTTCGACATCAAC
XM_005263473.1      TCGGAGGTGAGCGTGTGCTCGGAGCCCGTGTGGAAGCAGCGGCTGGAGTTCGACATCAAC
                    ************************************************************

HsCD00516484        ATCTGCGACCTGCCCCGCATGGCCCGTCTCTGCTTTGCGCTGTACGCCGTGATCGAGAAA
NM_005026.3         ATCTGCGACCTGCCCCGCATGGCCCGTCTCTGCTTTGCGCTGTACGCCGTGATCGAGAAA
XM_005263473.1      ATCTGCGACCTGCCCCGCATGGCCCGTCTCTGCTTTGCGCTGTACGCCGTGATCGAGAAA
                    ************************************************************

HsCD00516484        GCCAAGAAGGCTCGCTCCACCAAGAAGAAGTCCAAGAAGGCGGACTGCCCCATTGCCTGG
NM_005026.3         GCCAAGAAGGCTCGCTCCACCAAGAAGAAGTCCAAGAAGGCGGACTGCCCCATTGCCTGG
XM_005263473.1      GCCAAGAAGGCTCGCTCCACCAAGAAGAAGTCCAAGAAGGCGGACTGCCCCATTGCCTGG
                    ************************************************************

HsCD00516484        GCCAACCTCATGCTGTTTGACTACAAGGACCAGCTTAAGACCGGGGAACGCTGCCTCTAC
NM_005026.3         GCCAACCTCATGCTGTTTGACTACAAGGACCAGCTTAAGACCGGGGAACGCTGCCTCTAC
XM_005263473.1      GCCAACCTCATGCTGTTTGACTACAAGGACCAGCTTAAGACCGGGGAACGCTGCCTCTAC
                    ************************************************************

HsCD00516484        ATGTGGCCCTCCGTCCCAGATGAGAAGGGCGAGCTGCTGAACCCCACGGGCACTGTGCGC
NM_005026.3         ATGTGGCCCTCCGTCCCAGATGAGAAGGGCGAGCTGCTGAACCCCACGGGCACTGTGCGC
XM_005263473.1      ATGTGGCCCTCCGTCCCAGATGAGAAGGGCGAGCTGCTGAACCCCACGGGCACTGTGCGC
                    ************************************************************

HsCD00516484        AGTAACCCCAACACGGATAGCGCCGCTGCCCTGCTCATCTGCCTGCCCGAGGTGGCCCCG
NM_005026.3         AGTAACCCCAACACGGATAGCGCCGCTGCCCTGCTCATCTGCCTGCCCGAGGTGGCCCCG
XM_005263473.1      AGTAACCCCAACACGGATAGCGCCGCTGCCCTGCTCATCTGCCTGCCCGAGGTGGCCCCG
                    ************************************************************

HsCD00516484        CACCCCGTGTACTACCCCGCCCTGGAGAAGATCTTGGAGCTGGGGCGACACAGCGAGTGT
NM_005026.3         CACCCCGTGTACTACCCCGCCCTGGAGAAGATCTTGGAGCTGGGGCGACACAGCGAGTGT
XM_005263473.1      CACCCCGTGTACTACCCCGCCCTGGAGAAGATCTTGGAGCTGGGGCGACACAGCGAGTGT
                    ************************************************************

HsCD00516484        GTGCATGTCACCGAGGAGGAGCAGCTGCAGCTGCGGGAAATCCTGGAGCGGCGGGGGTCT
NM_005026.3         GTGCATGTCACCGAGGAGGAGCAGCTGCAGCTGCGGGAAATCCTGGAGCGGCGGGGGTCT
XM_005263473.1      GTGCATGTCACCGAGGAG---GAGCTGCAGCTGCGGGAAATCCTGGAGCGGCGGGGGTCT
                    ******************    **************************************

HsCD00516484        GGGGAGCTGTATGAGCACGAGAAGGACCTGGTGTGGAAGCTGCGGCATGAAGTCCAGGAG
NM_005026.3         GGGGAGCTGTATGAGCACGAGAAGGACCTGGTGTGGAAGCTGCGGCATGAAGTCCAGGAG
XM_005263473.1      GGGGAGCTGTATGAGCACGAGAAGGACCTGGTGTGGAAGCTGCGGCATGAAGTCCAGGAG
                    ************************************************************

HsCD00516484        CACTTCCCGGAGGCGCTAGCCCGGCTGCTGCTGGTCACCAAGTGGAACAAGCATGAGGAT
NM_005026.3         CACTTCCCGGAGGCGCTAGCCCGGCTGCTGCTGGTCACCAAGTGGAACAAGCATGAGGAT
XM_005263473.1      CACTTCCCGGAGGCGCTAGCCCGGCTGCTGCTGGTCACCAAGTGGAACAAGCATGAGGAT
                    ************************************************************

HsCD00516484        GTGGCCCAGATGCTCTACCTGCTGTGCTCCTGGCCGGAGCTGCCCGTCCTGAGCGCCCTG
NM_005026.3         GTGGCCCAGATGCTCTACCTGCTGTGCTCCTGGCCGGAGCTGCCCGTCCTGAGCGCCCTG
XM_005263473.1      GTGGCCCAGATGCTCTACCTGCTGTGCTCCTGGCCGGAGCTGCCCGTCCTGAGCGCCCTG
                    ************************************************************

HsCD00516484        GAGCTGCTAGACTTCAGCTTCCCCGATTGCCACGTAGGCTCCTTCGCCATCAAGTCGCTG
NM_005026.3         GAGCTGCTAGACTTCAGCTTCCCCGATTGCCACGTAGGCTCCTTCGCCATCAAGTCGCTG
XM_005263473.1      GAGCTGCTAGACTTCAGCTTCCCCGATTGCCACGTAGGCTCCTTCGCCATCAAGTCGCTG
                    ************************************************************

HsCD00516484        CGGAAACTGACGGACGATGAGCTGTTCCAGTACCTGCTGCAGCTGGTGCAGGTGCTCAAG
NM_005026.3         CGGAAACTGACGGACGATGAGCTGTTCCAGTACCTGCTGCAGCTGGTGCAGGTGCTCAAG
XM_005263473.1      CGGAAACTGACGGACGATGAGCTGTTCCAGTACCTGCTGCAGCTGGTGCAGGTGCTCAAG
                    ************************************************************

HsCD00516484        TACGAGTCCTACCTGGACTGCGAGCTGACCAAATTCCTGCTGGACCGGGCCCTGGCCAAC
NM_005026.3         TACGAGTCCTACCTGGACTGCGAGCTGACCAAATTCCTGCTGGACCGGGCCCTGGCCAAC
XM_005263473.1      TACGAGTCCTACCTGGACTGCGAGCTGACCAAATTCCTGCTGGACCGGGCCCTGGCCAAC
                    ************************************************************

HsCD00516484        CGCAAGATCGGCCACTTCCTTTTCTGGCACCTCCGCTCCGAGATGCACGTGCCGTCGGTG
NM_005026.3         CGCAAGATCGGCCACTTCCTTTTCTGGCACCTCCGCTCCGAGATGCACGTGCCGTCGGTG
XM_005263473.1      CGCAAGATCGGCCACTTCCTTTTCTGGCACCTCCGCTCCGAGATGCACGTGCCGTCGGTG
                    ************************************************************

HsCD00516484        GCCCTGCGCTTCGGCCTCATCCTGGAGGCCTACTGCAGGGGCAGCACCCACCACATGAAG
NM_005026.3         GCCCTGCGCTTCGGCCTCATCCTGGAGGCCTACTGCAGGGGCAGCACCCACCACATGAAG
XM_005263473.1      GCCCTGCGCTTCGGCCTCATCCTGGAGGCCTACTGCAGGGGCAGCACCCACCACATGAAG
                    ************************************************************

HsCD00516484        GTGCTGATGAAGCAGGGGGAAGCACTGAGCAAACTGAAGGCCCTGAATGACTTCGTCAAG
NM_005026.3         GTGCTGATGAAGCAGGGGGAAGCACTGAGCAAACTGAAGGCCCTGAATGACTTCGTCAAG
XM_005263473.1      GTGCTGATGAAGCAGGGGGAAGCACTGAGCAAACTGAAGGCCCTGAATGACTTCGTCAAG
                    ************************************************************

HsCD00516484        CTGAGCTCTCAGAAGACCCCCAAGCCCCAGACCAAGGAGCTGATGCACTTGTGCATGCGG
NM_005026.3         CTGAGCTCTCAGAAGACCCCCAAGCCCCAGACCAAGGAGCTGATGCACTTGTGCATGCGG
XM_005263473.1      CTGAGCTCTCAGAAGACCCCCAAGCCCCAGACCAAGGAGCTGATGCACTTGTGCATGCGG
                    ************************************************************

HsCD00516484        CAGGAGGCCTACCTAGAGGCCCTCTCCCACCTGCAGTCCCCACTCGACCCCAGCACCCTG
NM_005026.3         CAGGAGGCCTACCTAGAGGCCCTCTCCCACCTGCAGTCCCCACTCGACCCCAGCACCCTG
XM_005263473.1      CAGGAGGCCTACCTAGAGGCCCTCTCCCACCTGCAGTCCCCACTCGACCCCAGCACCCTG
                    ************************************************************

HsCD00516484        CTGGCTGAAGTCTGCGTGGAGCAGTGCACCTTCATGGACTCCAAGATGAAGCCCCTGTGG
NM_005026.3         CTGGCTGAAGTCTGCGTGGAGCAGTGCACCTTCATGGACTCCAAGATGAAGCCCCTGTGG
XM_005263473.1      CTGGCTGAAGTCTGCGTGGAGCAGTGCACCTTCATGGACTCCAAGATGAAGCCCCTGTGG
                    ************************************************************

HsCD00516484        ATCATGTACAGCAACGAGGAGGCAGGCAGCGGCGGCAGCGTGGGCATCATCTTTAAGAAC
NM_005026.3         ATCATGTACAGCAACGAGGAGGCAGGCAGCGGCGGCAGCGTGGGCATCATCTTTAAGAAC
XM_005263473.1      ATCATGTACAGCAACGAGGAGGCAGGCAGCGGCGGCAGCGTGGGCATCATCTTTAAGAAC
                    ************************************************************

HsCD00516484        GGGGATGACCTCCGGCAGGACATGCTGACCCTGCAGATGATCCAGCTCATGGACGTCCTG
NM_005026.3         GGGGATGACCTCCGGCAGGACATGCTGACCCTGCAGATGATCCAGCTCATGGACGTCCTG
XM_005263473.1      GGGGATGACCTCCGGCAGGACATGCTGACCCTGCAGATGATCCAGCTCATGGACGTCCTG
                    ************************************************************

HsCD00516484        TGGAAGCAGGAGGGGCTGGACCTGAGGATGACCCCCTATGGCTGCCTCCCCACCGGGGAC
NM_005026.3         TGGAAGCAGGAGGGGCTGGACCTGAGGATGACCCCCTATGGCTGCCTCCCCACCGGGGAC
XM_005263473.1      TGGAAGCAGGAGGGGCTGGACCTGAGGATGACCCCCTATGGCTGCCTCCCCACCGGGGAC
                    ************************************************************

HsCD00516484        CGCACAGGCCTCATTGAGGTGGTACTCCGTTCAGACACCATCGCCAACATCCAACTCAAC
NM_005026.3         CGCACAGGCCTCATTGAGGTGGTACTCCGTTCAGACACCATCGCCAACATCCAACTCAAC
XM_005263473.1      CGCACAGGCCTCATTGAGGTGGTACTCCGTTCAGACACCATCGCCAACATCCAACTCAAC
                    ************************************************************

HsCD00516484        AAGAGCAACATGGCAGCCACAGCCGCCTTCAACAAGGATGCCCTGCTCAACTGGCTGAAG
NM_005026.3         AAGAGCAACATGGCAGCCACAGCCGCCTTCAACAAGGATGCCCTGCTCAACTGGCTGAAG
XM_005263473.1      AAGAGCAACATGGCAGCCACAGCCGCCTTCAACAAGGATGCCCTGCTCAACTGGCTGAAG
                    ************************************************************

HsCD00516484        TCCAAGAACCCGGGGGAGGCCCTGGATCGAGCCATTGAGGAGTTCACCCTCTCCTGTGCT
NM_005026.3         TCCAAGAACCCGGGGGAGGCCCTGGATCGAGCCATTGAGGAGTTCACCCTCTCCTGTGCT
XM_005263473.1      TCCAAGAACCCGGGGGAGGCCCTGGATCGAGCCATTGAGGAGTTCACCCTCTCCTGTGCT
                    ************************************************************

HsCD00516484        GGCTATTGTGTGGCCACATATGTGCTGGGCATTGGCGATCGGCACAGCGACAACATCATG
NM_005026.3         GGCTATTGTGTGGCCACATATGTGCTGGGCATTGGCGATCGGCACAGCGACAACATCATG
XM_005263473.1      GGCTATTGTGTGGCCACATATGTGCTGGGCATTGGCGATCGGCACAGCGACAACATCATG
                    ************************************************************

HsCD00516484        ATCCGAGAGAGTGGGCAGCTGTTCCACATTGATTTTGGCCACTTTCTGGGGAATTTCAAG
NM_005026.3         ATCCGAGAGAGTGGGCAGCTGTTCCACATTGATTTTGGCCACTTTCTGGGGAATTTCAAG
XM_005263473.1      ATCCGAGAGAGTGGGCAGCTGTTCCACATTGATTTTGGCCACTTTCTGGGGAATTTCAAG
                    ************************************************************

HsCD00516484        ACCAAGTTTGGAATCAACCGCGAGCGTGTCCCATTCATCCTCACCTACGACTTTGTCCAT
NM_005026.3         ACCAAGTTTGGAATCAACCGCGAGCGTGTCCCATTCATCCTCACCTACGACTTTGTCCAT
XM_005263473.1      ACCAAGTTTGGAATCAACCGCGAGCGTGTCCCATTCATCCTCACCTACGACTTTGTCCAT
                    ************************************************************

HsCD00516484        GTGATTCAGCAGGGGAAGACTAATAATAGTGAGAAATTTGAACGGTTCCGGGGCTACTGT
NM_005026.3         GTGATTCAGCAGGGGAAGACTAATAATAGTGAGAAATTTGAACGGTTCCGGGGCTACTGT
XM_005263473.1      GTGATTCAGCAGGGGAAGACTAATAATAGTGAGAAATTTGAACGGTTCCGGGGCTACTGT
                    ************************************************************

HsCD00516484        GAAAGGGCCTACACCATCCTGCGGCGCCACGGGCTTCTCTTCCTCCACCTCTTTGCCCTG
NM_005026.3         GAAAGGGCCTACACCATCCTGCGGCGCCACGGGCTTCTCTTCCTCCACCTCTTTGCCCTG
XM_005263473.1      GAAAGGGCCTACACCATCCTGCGGCGCCACGGGCTTCTCTTCCTCCACCTCTTTGCCCTG
                    ************************************************************

HsCD00516484        ATGCGGGCGGCAGGCCTGCCTGAGCTCAGCTGCTCCAAAGACATCCAGTATCTCAAGGAC
NM_005026.3         ATGCGGGCGGCAGGCCTGCCTGAGCTCAGCTGCTCCAAAGACATCCAGTATCTCAAGGAC
XM_005263473.1      ATGCGGGCGGCAGGCCTGCCTGAGCTCAGCTGCTCCAAAGACATCCAGTATCTCAAGGAC
                    ************************************************************

HsCD00516484        TCCCTGGCACTGGGGAAAACAGAGGAGGAGGCACTGAAGCACTTCCGAGTGAAGTTTAAC
NM_005026.3         TCCCTGGCACTGGGGAAAACAGAGGAGGAGGCACTGAAGCACTTCCGAGTGAAGTTTAAC
XM_005263473.1      TCCCTGGCACTGGGGAAAACAGAGGAGGAGGCACTGAAGCACTTCCGAGTGAAGTTTAAC
                    ************************************************************

HsCD00516484        GAAGCCCTCCGTGAGAGCTGGAAAACCAAAGTGAACTGGCTGGCCCACAACGTGTCCAAA
NM_005026.3         GAAGCCCTCCGTGAGAGCTGGAAAACCAAAGTGAACTGGCTGGCCCACAACGTGTCCAAA
XM_005263473.1      GAAGCCCTCCGTGAGAGCTGGAAAACCAAAGTGAACTGGCTGGCCCACAACGTGTCCAAA
                    ************************************************************

HsCD00516484        GACAACAGGCAG---
NM_005026.3         GACAACAGGCAGTAG
XM_005263473.1      GACAACAGGCAGTAG
                    ************   

Pathways

NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : Internalization of ErbB1
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : PDGFR-beta signaling pathway
NCI : Signaling events mediated by TCPTP
NCI : TRAIL signaling pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 667539
Original Clone ID : ccsbBroadEn_01204

Organism


TAX_ID : 9606
Species Specific ID: 5293

Genome

Chromosome : 1
Map Location : 1p36.2
Ensembl : ENSG00000171608

Reagents

Labome : PIK3CD-antibody