DNASU Plasmid Repository • 480.965.5697 | Email

PPP1CC (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPP1CC
Gene Name:  protein phosphatase 1, catalytic subunit, gamma isozyme
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH141573.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00005168

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 972nts         Open reading frame : 1 to 972
Reference Sequence Alignment

ATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGA
GGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTA
AAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAA
ATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGT
TTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCA
TTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTT
CTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGT
AAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCG
ATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTT
CAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTT
CTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGAC
AGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGAT
TTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAG
AGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGT
GCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAG
AAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAA
GCAAAGAAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1145
Start on reference sequence 174
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPP1CC
Symbol Nomenclature : PPP1CC
SYNONYM : PP-1G; PP1C; PPP1G
Designation : protein phosphatase 1, catalytic subunit, gamma isoform|protein phosphatase 1C catalytic subunit|serine/threonine phosphatase 1 gamma|serine/threonine-protein phosphatase PP1-gamma catalytic subunit
Full Nomenclature : protein phosphatase 1, catalytic subunit, gamma isozyme
GENEID : 5501
GI : 60654286
GenBank Accession : AY892919
HGNC : 9283
MIM : 176914
Vega : OTTHUMG00000169531
Target GenBank: BC014073

 

Reference Sequence Alignment

  

HsCD00005168        ATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGA
NM_002710.3         ATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGA
NM_002708.3         ATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGTGCAG
NM_001244974.1      ATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGA
                    *** * ** : .** **.******.* ***:  ** *** ..** ************...

HsCD00005168        GGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTA
NM_002710.3         GGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTA
NM_002708.3         GGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTGCCTG
NM_001244974.1      GGGTCCAAGCCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTA
                    ** ** ..****** ********.***** ...***** **.***.*.**:****** *.

HsCD00005168        AAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAA
NM_002710.3         AAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAA
NM_002708.3         AAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCTCAAG
NM_001244974.1      AAGTCTCGTGAAATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAA
                    **.** ** **.** ***** ** ***** ** **:**.**.** **.*****.*****.

HsCD00005168        ATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGT
NM_002710.3         ATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGT
NM_002708.3         ATCTGCGGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGGCGGT
NM_001244974.1      ATATGTGGTGACATCCATGGACAATACTATGATTTGCTGCGACTTTTTGAGTACGGTGGT
                    **.** ********.** **.**.***** **  * ********:******** ** ***

HsCD00005168        TTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCA
NM_002710.3         TTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCA
NM_002708.3         TTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCAGTCC
NM_001244974.1      TTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGAAAGCAGTCA
                    *****:**.**.*********** ***** ********************.********.

HsCD00005168        TTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTT
NM_002710.3         TTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTT
NM_002708.3         TTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTTCCTG
NM_001244974.1      TTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCTGAGAATTTTTTTCTT
                    ******** ********  *.******** **.**.**.** ** ***** ** ** ** 

HsCD00005168        CTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGT
NM_002710.3         CTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGT
NM_002708.3         CTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGAGTGC
NM_001244974.1      CTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGATGAATGT
                    ***.*:******** **.***************.*.** *****:** ** *****.** 

HsCD00005168        AAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCG
NM_002710.3         AAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCG
NM_002708.3         AAGAGACGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCTGCCC
NM_001244974.1      AAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCG
                    **.***.*.******** *****.******** *****:***** ** *****  *.** 

HsCD00005168        ATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTT
NM_002710.3         ATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTT
NM_002708.3         ATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGACCTG
NM_001244974.1      ATAGCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTT
                    **.**.*****.***** **.*****.******** ** *****  *.**.**.** ** 

HsCD00005168        CAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTT
NM_002710.3         CAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTT
NM_002708.3         CAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGGCCTG
NM_001244974.1      CAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTT
                    **.********************.** *****.**.**:*****.**:** **.** ** 

HsCD00005168        CTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGAC
NM_002710.3         CTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGAC
NM_002708.3         CTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAACGAC
NM_001244974.1      CTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGAC
                    ** ***** **  ************* ** **.** **  :.******** **.** ***

HsCD00005168        AGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGAT
NM_002710.3         AGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGAT
NM_002708.3         CGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGCCAAGTTCCTCCACAAGCACGAC
NM_001244974.1      AGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGAT
                    .*:**.** ** ** **.*****:**.**.***** **.**.** ***** ***** ** 

HsCD00005168        TTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAG
NM_002710.3         TTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAG
NM_002708.3         TTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGACGGCTACGAGTTCTTTGCCAAG
NM_001244974.1      TTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAG
                    ***** ** **.** .****.** ********:***** **.** **.** *****.***

HsCD00005168        AGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGT
NM_002710.3         AGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGT
NM_002708.3         CGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTGTGGCGAGTTTGACAATGCTGGC
NM_001244974.1      AGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTTGACAATGCAGGT
                    .***** **** **:** ** **:** ***** ** ** **.**************:** 

HsCD00005168        GCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAG
NM_002710.3         GCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAG
NM_002708.3         GCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTTCCAGATCCTCAAGCCCGCCGAC
NM_001244974.1      GCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAG
                    ***************** **.**.**.***** ***** *****  *.***** **.** 

HsCD00005168        AAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAA
NM_002710.3         AAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGGTATGATCACAAAGCAA
NM_002708.3         AAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAACCCTGGAGGCCGACCCATCACC
NM_001244974.1      AAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGTTGCATCAGGCCTGAAC
                    **.** ***  .**  .*. *...   . :.  *  ....  * :.    .  ..: ...

HsCD00005168        GCAAAGAAATTG------------------------------------------
NM_002710.3         GCAAAGAAATAG------------------------------------------
NM_002708.3         CCACCCCGCAATTCCGCCAAAGCCAAGAAATAG---------------------
NM_001244974.1      CCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGA
                     *. . .   :                                           

Pathways

NCI : Aurora B signaling
NCI : Insulin-mediated glucose transport
Panther : Dopamine receptor mediated signaling pathway
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Disease
Reactome : Downregulation of TGF-beta receptor signaling
Reactome : Hormone-sensitive lipase (HSL)-mediated triacylglycerol hydrolysis
Reactome : Lipid digestion, mobilization, and transport
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : M Phase
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Separation of Sister Chromatids
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGF-beta receptor signaling activates SMADs
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer

Clone

Cloning Information : 141573
HIP Master Clone ID : 117840
Original Clone ID : FLH141573.01L

Organism


TAX_ID : 9606
Species Specific ID: 5501

Genome

Chromosome : 12
Map Location : 12q24.1-q24.2
Ensembl : ENSG00000186298

Reagents

Labome : PPP1CC-antibody