DNASU Plasmid Repository • 480.965.5697 | Email

BT_3300 (B. thetaiotaomicron VPI-5482 ) in pMCSG19B (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BT_3300
Gene Name:  beta-glucosidase
Sequence             
Original Clone ID: APC62257.1_SG302_pMCSG19B
Keyword: partial cds
Species: Bacteroides thetaiotaomicron VPI-5482
Type: cDNA
Vector Name: pMCSG19B               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
Jessica Bearden
BtCD00519217

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1194nts         Open reading frame : 45 to 1238

AACTCGGGGGATTGGGTACGAAACCTGTACTTCCATCCAATGCCGACCCTCAATCTGTAG
AAACAGCATTAAATGTTGCCAGAGAGGGACTTGTTCTTTTGAAGAATGAAAACAACATTC
TTCCTATCAATCCCCAAAAATACAAACATATTATCGTTACCGGCAAAAATGCACATGGAT
ATGTACATGGTGGTGGTAGTGGCGCTGTAGTTCCTTTCCATTATACCAATTTATTCGACG
GAATCCAAAAAGAAGGTAAACTGAATAATGTAAAAGTAGAATATATTGATGAACTCGACT
TTATGCCGTCCATCATGTATACAGACGACAATCTCAACGAAAAGGGATTTCATGCCGAAT
ACTTCAAGAATATTCACTTCGAAGGAGCCCCTGTGGTAAAACAGACTGAGAAAAAAATCA
ATTATTCTTGGGCTGCAGGCACAGAATTGGAAGGTATGCCCAAAGATTATTTCTCTGTGA
AATGGTACAGTACAATGTGCGTAGACGAAACCGCTGACTATGAGTTCACATTAGGAGGCG
ACGATGGTTATAAATTGTTTATCAACGACCAACCGATTATTGATGACTGGACGCCCGGAG
GTTTCAGAACGACCAATGTTACCAAGACACTAAAAGCCGGTGAAAAATATCATGTACGTG
TAGAATACTATCAGCAGGGTGGTGGAGCAGGTATCTGCTTTTTATGGAAACGTAAGAACG
AGACTCAGAATAAGTTTGCCGATTACCTGAACAAAGCAGATTTAGTGATTGCCTGCTTCG
GTCATAGTTCCGATACAGAAGGAGAAGCAAGCGACCGCACATTCGAACTGCCCGAAGTAG
ATAAAAAAATGCTGGCCAGCTTATCCGGATGTAAAAAGCCTGTTATCGGTATTGTAAATG
CCGGAGGTAATATTGAAATGCAAAAATGGGAACCGTCTTTGAAGGGGCTTATTTGGGGAT
TTTATGGAGGTCAGGAAGCGGGAACAGCTATCGGCGAAGCTTTATTCGGTAAAGTTAACC
CATCAGGAAAATTACCTATGACTTTTGAAAAGAAATGGGAAGACAGCCCCGCTTACAACA
GCTATCATGACCCGGATAAAGACAAACATGTAGCATATACGGAAGGAATATTCATCGGCT
ATCGCGGCTATGACAAATTGAAACGTGAAGTACAATATCCTTTTGGCTACGGATTGTCTT
ATACCACCTTTAAGCTATCTAATATAGTAGTCTCATAACATTGGAAGTGGATAACGGATC
CGAATTCGAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GCC

3' Linker Sequence:
TAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in APC62257.1
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19B

pMCSG19B in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV cleavage site, His tag, and TEV protease cleavage site; ampicillin resistance; ligation independent cloning (LIC).
Comments: Similar to pMCSG19C except location of the TVMV CDS. See http://bioinformatics.anl.gov/mcsg/technologies/vectors.html for more details
Size (bp): 7468
Parent Vector: None
Empty Vector: None
Properties: bacterial expression
Author Name: PSI
Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori pBR322 origin of replication 5432 5432
gene fragment TVMV cds TVMV protease coding sequence 1881 2591
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV cleavage site 286 306
protease cleavage site TEV TEV protease cleavage site 223 243
recombination site LIC Ligation Independent Cloning (LIC) recombination site 204 235
repressor binding site tet operator TetO fragment 2610 2765
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI cds 3072 4031
selectable marker AmpR Ampicillin resistance 6220 7080
tag MBP Maltose binding protein tag 337 1143
tag His N terminal His tag 268 285
trxn termination sequence T7 term T7 termination sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : BT_3300
GENEID : 1076340
Locus Tag : BT_3300
GI : 29340615
Target GenBank: None

 

Protein

SMART domain : PA14 :
Structural Annotation Wiki : APC62257.1

Clone

Cloning Information : 575249
HIP Master Clone ID : 480848
Original Clone ID : APC62257.1_SG302_pMCSG19B

Experimental

TargetTrack - Experimental data : APC62257.1

Organism


TAX_ID : 226186
Species Specific ID: 1076340

Reagents

Labome : BT_3300-cDNA