DNASU Plasmid Repository • 480.965.5697 | Email

Taci_0107 (T. acidaminovorans DSM 6589 ) in pMCSG48

TOP

Explanation of Terms


Gene: Gene Symbol:  Taci_0107
Gene Name:  DtxR family iron (metal) dependent repressor
Sequence             
Original Clone ID: APC101359.103
Keyword: None
Species: Thermanaerovibrio acidaminovorans DSM 6589
Type: cDNA
Vector Name: pMCSG48               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Midwest Center for Structural Genomics
Argonne National Laboratory
PSI:Biology
Jessica Bearden
TaCD00520123

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 657nts         Open reading frame : 51 to 707

TGGCTGCCCGTAATAACAACAACGAGAACCTGTACTTCCAATCCAATGCCATGTCGTCCA
GGCGCTCGGAGGACTACCTGGAGGAGATGCTGCTCCAGGAGATCCAGGGGGGCACCCCCT
CGGTCACCGGCCTAGCCAGGGCCCTGGAGGTGACCAAGGGCACGGTGGTGTCGGTGCTTA
AGAAGCTGTCCTCCGAGGGGCTCCTGTCCCATGAGAGGTACGGCACCCCCGCCCTGACCG
AGGCGGGCAGGGCCAGGGCGCTCTCCATCTACCGGAGGCACTACAACCTCGTCTTCTTCT
TGGAGCTGCTGGGGGTGGATCAGGACAGGGCCGGCCGGATCGCCTGCGAGATGGAGCACC
TGCTGGACGATGACTTGGAGGGGCGGATCTTCGCCCTGTCGGAGTTCATCTCCCAGGGGA
TCAAGGCCTCCGAGGGGTGGGCACGGGAGCTTCAGGAGAGGCTCTCGAACCCAGGGACCC
TGCCCCATCCCCTGTGTCTCGCCGGCTCCCGGACGTGCAGGGTGGTCCGCATCACCGCCG
AGGGGCCATTGAGGAAGCGCCTGATGGAGATGGGGTTCATCCCCGGGGCATCGGTGGAGC
TGGCGGGAGAGTCCTGGGATCGGGACCCGCTCAAGGTGAGGCTCCAGGGACGGGTGGTGG
CGTTGAGGCGGGACGAGGCGTCCCGGGTCTGGGTGACCGAGGCTTAACATTGGAAGTGGA
TAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC101359
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG48

pMCSG48 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pMCSG48F
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and N-terminal 8xHis NusA tag, TEV cleavable; ampicillin resistance in bacteria; Ligation Independent cloning
Comments: None
Size (bp): 6741
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence: Not Available

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 4735 4735
gene fragment NusA NusA cds 252 1710
ligation independent cloning LIC LIC site 205 234
primer forward primer Forward sequencing primer GAAGGGTTGACCGACGAAAAAGC 0 0
promoter T7 T7 promoter 2345 3304
protease cleavage site TEV TEV protease cleavage site 223 243
repressor protein gene LacI LacI cds 2345 3304
selectable marker AmpR Ampicillin resistance gene 5493 6353
tag His N-terminal 8xHis tag 1717 1740
trxn termination sequence T7 term T7 terminator 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : Taci_0107
GENEID : 8629917
Locus Tag : Taci_0107
GI : 269099360
Target GenBank: None

 

Protein

SMART domain : HTH_DTXR : Helix-turn-helix diphteria tox regulatory element
SMART domain : FeoA :
Structural Annotation Wiki : TOPSAN
Structural Annotation Wiki : MCSG-APC101359

Clone

Cloning Information : 584739
HIP Master Clone ID : 487668
Original Clone ID : APC101359.103

Experimental

TargetTrack - Experimental data : MCSG-APC101359

Organism


TAX_ID : 525903
Species Specific ID: 8629917

Reagents

Labome : Taci_0107-cDNA