DNASU Plasmid Repository • 480.965.5697 | Email

PDIA3 (Homo sapiens) in pGEc2-DEST (Flag-tagged mammalian expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PDIA3
Gene Name:  protein disulfide isomerase family A, member 3
Sequence             
Original Clone ID: None
Keyword: partial cds (C-terminal deletion)
Species: Homo sapiens
Type: cDNA
Vector Name: pGEc2-DEST               Format:  FUSION
Source: Glyco-enzyme clone collection
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 25086069
Title: Restoration of Compact Golgi Morphology in Advanced Prostate Cancer Enhances Susceptibility to Galectin-1-induced Apoptosis by Modifying Mucin O-glycan Synthesis
Authors: Center for Personalized Diagnostics
Arizona State University
Kelley Moremen
University of Georgia
HsCD00521134

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA

 

Insert sequence: 1503nts         Open reading frame : 1 to 1503
Reference Sequence Alignment

ATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGC
CTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCC
GACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGC
AAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTA
GCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATAT
CCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACT
GCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGG
ACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTC
GATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGAT
AACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGA
GAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTG
GCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATT
TTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTA
CTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGA
AACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCT
GTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCT
GGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAG
GAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAAT
CTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTA
GTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAA
TTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGC
GAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGAT
GTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAG
AAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTA
CAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAG
GCA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pGEc2-DEST

pGEc2-DEST in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pGEc1-DEST F
Reverse:  pGEn1-DEST R
Description: Mammalian expression vector with a CMV promoter and C-terminal Superfolder GFP, AviTag and 10xHis tag; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments: None
Size (bp): 6852
Parent Vector: Name: pXKM
Description:
Empty Vector: EvNO00534627
Properties: Gateway, acceptor (destination), fluorescent marker, mammalian transduction, recombinational cloning, with tag/fusion/marker
Author Name: University of Georgia
Kelley Moremen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 1137 1804
death cassette ccdB ccdB death cassette (removed in plasmids with insert) 4211 4516
intron artificial intron artificial intron 2828 2960
poly-A signal BGH pA bovine growth hormone (BGH) polyadenylation signal 6028 6242
promoter CMV CMV promoter for expression in mammalian cells 2208 2790
recombination site attR2 attR2 recombinational cloning site 4557 4681
recombination site attR1 attR1 recombinational cloning site 2974 3101
recombination site 3'-ITR inverted terminal repeat sequence 6330 6459
selectable marker AmpR ampicillin resistance 129 989
selectable marker CmR Chloramphenicol resistance (CmR) gene (removed in plasmids with insert) 3210 3859
tag AviTag C-terminal AviTag 5378 5428
tag GFP C-terminal super GFP 4682 5377
tag His C-terminal 10xHis tag 5429 5452
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 5480 6021

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PDIA3
Symbol Nomenclature : PDIA3
SYNONYM : ER60; ERp57; ERp60; ERp61; GRP57; GRP58; HEL-S-269; HEL-S-93n; HsT17083; P58; PI-PLC
Designation : 58 kDa glucose-regulated protein|58 kDa microsomal protein|ER protein 57|ER protein 60|disulfide isomerase ER-60|endoplasmic reticulum P58|endoplasmic reticulum resident protein 57|endoplasmic reticulum resident protein 60|epididymis secretory protein Li 269|epididymis secretory sperm binding protein Li 93n|glucose regulated protein, 58kDa|phospholipase C-alpha|protein disulfide isomerase-associated 3|protein disulfide-isomerase A3
Full Nomenclature : protein disulfide isomerase family A, member 3
GENEID : 2923
GenBank Accession : BC014433
HGNC : 4606
MIM : 602046
Vega : OTTHUMG00000044444
Target GenBank: BC014433

 

Reference Sequence Alignment

  

HsCD00521134      ATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGC
NM_005313.4       ATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGC
                  ************************************************************

HsCD00521134      CTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCC
NM_005313.4       CTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCC
                  ************************************************************

HsCD00521134      GACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGC
NM_005313.4       GACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGC
                  ************************************************************

HsCD00521134      AAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTA
NM_005313.4       AAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTA
                  ************************************************************

HsCD00521134      GCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATAT
NM_005313.4       GCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATAT
                  ************************************************************

HsCD00521134      CCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACT
NM_005313.4       CCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACT
                  ************************************************************

HsCD00521134      GCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGG
NM_005313.4       GCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGG
                  ************************************************************

HsCD00521134      ACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTC
NM_005313.4       ACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTC
                  ************************************************************

HsCD00521134      GATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGAT
NM_005313.4       GATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGAT
                  ************************************************************

HsCD00521134      AACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGA
NM_005313.4       AACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGA
                  ************************************************************

HsCD00521134      GAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTG
NM_005313.4       GAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTG
                  ************************************************************

HsCD00521134      GCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATT
NM_005313.4       GCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATT
                  ************************************************************

HsCD00521134      TTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTA
NM_005313.4       TTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTA
                  ************************************************************

HsCD00521134      CTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGA
NM_005313.4       CTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGA
                  ************************************************************

HsCD00521134      AACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCT
NM_005313.4       AACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCT
                  ************************************************************

HsCD00521134      GTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCT
NM_005313.4       GTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCT
                  ************************************************************

HsCD00521134      GGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAG
NM_005313.4       GGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAG
                  ************************************************************

HsCD00521134      GAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAAT
NM_005313.4       GAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAAT
                  ************************************************************

HsCD00521134      CTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTA
NM_005313.4       CTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTA
                  ************************************************************

HsCD00521134      GTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAA
NM_005313.4       GTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAA
                  ************************************************************

HsCD00521134      TTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGC
NM_005313.4       TTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGC
                  ************************************************************

HsCD00521134      GAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGAT
NM_005313.4       GAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGAT
                  ************************************************************

HsCD00521134      GTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAG
NM_005313.4       GTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAG
                  ************************************************************

HsCD00521134      AAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTA
NM_005313.4       AAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTA
                  ************************************************************

HsCD00521134      CAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAG
NM_005313.4       CAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAG
                  ************************************************************

HsCD00521134      GCA---------------
NM_005313.4       GCACAGGAGGATCTCTAA
                  ***               

Pathways

Reactome : Adaptive Immune System
Reactome : Antigen Presentation: Folding, assembly and peptide loading of class I MHC
Reactome : Antigen processing-Cross presentation
Reactome : Asparagine N-linked glycosylation
Reactome : Calnexin/calreticulin cycle
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : ER-Phagosome pathway
Reactome : Immune System
Reactome : Metabolism of proteins
Reactome : N-glycan trimming in the ER and Calnexin/Calreticulin cycle
Reactome : Post-translational protein modification

Protein

HPRD : 03625

Clone

Cloning Information : 596229

Organism


TAX_ID : 9606
Species Specific ID: 2923

Genome

Chromosome : 15
Map Location : 15q15
Ensembl : ENSG00000167004

Reagents

Labome : ERp57-antibody