DNASU Plasmid Repository • 480.965.5697 | Email

GJA1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GJA1
Gene Name:  gap junction protein, alpha 1, 43kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH140325.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00005245

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1149nts         Open reading frame : 1 to 1149
Reference Sequence Alignment

ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCT
GGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCG
GTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGT
TGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTG
CAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATG
CGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGT
GTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAA
GAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTC
TTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGC
TTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTC
TCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCC
CTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTT
AAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGT
GGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCT
ATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAAT
TACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATG
GGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGAT
AACCAGAATTCAAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGAC
CAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTG
GAGATCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1237
Start on reference sequence 89
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GJA1
Symbol Nomenclature : GJA1
SYNONYM : AVSD3; CMDR; CX43; DFNB38; GJAL; HLHS1; HSS; ODDD
Designation : connexin 43|connexin-43|gap junction 43 kDa heart protein|gap junction alpha-1 protein
Full Nomenclature : gap junction protein, alpha 1, 43kDa
GENEID : 2697
GI : 61363755
GenBank Accession : AY890497
HGNC : 4274
MIM : 121014
Vega : OTTHUMG00000015479
Target GenBank: BC026329

 

Reference Sequence Alignment

  

HsCD00005245      ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCT
NM_000165.3       ATGGGTGACTGGAGCGCCTTAGGCAAACTCCTTGACAAGGTTCAAGCCTACTCAACTGCT
                  ************************************************************

HsCD00005245      GGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCG
NM_000165.3       GGAGGGAAGGTGTGGCTGTCAGTACTTTTCATTTTCCGAATCCTGCTGCTGGGGACAGCG
                  ************************************************************

HsCD00005245      GTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGT
NM_000165.3       GTTGAGTCAGCCTGGGGAGATGAGCAGTCTGCCTTTCGTTGTAACACTCAGCAACCTGGT
                  ************************************************************

HsCD00005245      TGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTG
NM_000165.3       TGTGAAAATGTCTGCTATGACAAGTCTTTCCCAATCTCTCATGTGCGCTTCTGGGTCCTG
                  ************************************************************

HsCD00005245      CAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATG
NM_000165.3       CAGATCATATTTGTGTCTGTACCCACACTCTTGTACCTGGCTCATGTGTTCTATGTGATG
                  ************************************************************

HsCD00005245      CGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGT
NM_000165.3       CGAAAGGAAGAGAAACTGAACAAGAAAGAGGAAGAACTCAAGGTTGCCCAAACTGATGGT
                  ************************************************************

HsCD00005245      GTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAA
NM_000165.3       GTCAATGTGGACATGCACTTGAAGCAGATTGAGATAAAGAAGTTCAAGTACGGTATTGAA
                  ************************************************************

HsCD00005245      GAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTC
NM_000165.3       GAGCATGGTAAGGTGAAAATGCGAGGGGGGTTGCTGCGAACCTACATCATCAGTATCCTC
                  ************************************************************

HsCD00005245      TTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGC
NM_000165.3       TTCAAGTCTATCTTTGAGGTGGCCTTCTTGCTGATCCAGTGGTACATCTATGGATTCAGC
                  ************************************************************

HsCD00005245      TTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTC
NM_000165.3       TTGAGTGCTGTTTACACTTGCAAAAGAGATCCCTGCCCACATCAGGTGGACTGTTTCCTC
                  ************************************************************

HsCD00005245      TCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCC
NM_000165.3       TCTCGCCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCC
                  ************************************************************

HsCD00005245      CTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTT
NM_000165.3       CTGGCCTTGAATATCATTGAACTCTTCTATGTTTTCTTCAAGGGCGTTAAGGATCGGGTT
                  ************************************************************

HsCD00005245      AAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGT
NM_000165.3       AAGGGAAAGAGCGACCCTTACCATGCGACCAGTGGTGCGCTGAGCCCTGCCAAAGACTGT
                  ************************************************************

HsCD00005245      GGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCT
NM_000165.3       GGGTCTCAAAAATATGCTTATTTCAATGGCTGCTCCTCACCAACCGCTCCCCTCTCGCCT
                  ************************************************************

HsCD00005245      ATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAAT
NM_000165.3       ATGTCTCCTCCTGGGTACAAGCTGGTTACTGGCGACAGAAACAATTCTTCTTGCCGCAAT
                  ************************************************************

HsCD00005245      TACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATG
NM_000165.3       TACAACAAGCAAGCAAGTGAGCAAAACTGGGCTAATTACAGTGCAGAACAAAATCGAATG
                  ************************************************************

HsCD00005245      GGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGAT
NM_000165.3       GGGCAGGCGGGAAGCACCATCTCTAACTCCCATGCACAGCCTTTTGATTTCCCCGATGAT
                  ************************************************************

HsCD00005245      AACCAGAATTCAAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGAC
NM_000165.3       AACCAGAATTCTAAAAAACTAGCTGCTGGACATGAATTACAGCCACTAGCCATTGTGGAC
                  ***********:************************************************

HsCD00005245      CAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTG
NM_000165.3       CAGCGACCTTCAAGCAGAGCCAGCAGTCGTGCCAGCAGCAGACCTCGGCCTGATGACCTG
                  ************************************************************

HsCD00005245      GAGATCTAG
NM_000165.3       GAGATCTAG
                  *********

Pathways

NCI : AP-1 transcription factor network
NCI : N-cadherin signaling events
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
Reactome : Formation of annular gap junctions
Reactome : Gap junction assembly
Reactome : Gap junction degradation
Reactome : Gap junction trafficking
Reactome : Gap junction trafficking and regulation
Reactome : Membrane Trafficking
Reactome : Microtubule-dependent trafficking of connexons from Golgi to the plasma membrane
Reactome : Oligomerization of connexins into connexons
Reactome : Regulation of gap junction activity
Reactome : Transport of connexins along the secretory pathway
Reactome : Transport of connexons to the plasma membrane
Reactome : c-src mediated regulation of Cx43 function and closure of gap junctions
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : TarBasePathway
WikiPathway : Wnt Signaling Pathway

Clone

Cloning Information : 140325
HIP Master Clone ID : 116592
Original Clone ID : FLH140325.01X

Organism


TAX_ID : 9606
Species Specific ID: 2697

Genome

Chromosome : 6
Map Location : 6q22.31
Ensembl : ENSG00000152661

Reagents

Labome : Cx43-antibody