DNASU Plasmid Repository • 480.965.5697 | Email

Caur_1185 (C. aurantiacus J-10-fl ) in pNIC28-Bsa4 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Caur_1185
Gene Name:  NADH dehydrogenase (quinone)
Sequence             
Original Clone ID: 013057
Keyword: None
Species: Chloroflexus aurantiacus J-10-fl
Type: cDNA
Vector Name: pNIC28-Bsa4               Format:  CLOSED
Source: New York Structural Genomics Research Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI:Biology
Albert Einstein College of Medicine
New York Structural Genomics Research Consortium
Steven Almo
CaCD00526032

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1605nts         Open reading frame : 21 to 1625

ACTCGTACTTCCAATCCATGGATCTTCACGAACTGGAAGCGATTGCTGAACGAGAACAGG
CACAACGTGCGCGTTTCCGCATCCTCTGCTGCGCTGCTGCCGGTTGCCAGGCTTCCGGCA
GCCTGGAGATTAAGCGTCGCTTAGAACTGGTGCTCTCCGCTGCCGGCAAACAGGCTGATG
TTGACGTTGTTCCGGTTGGGTGCATGGGATTGTGCGGTCACGGCCCGTTAGTTCGTCTGG
AACCGACCGGAAAGGTGTTCGAGCGCGTTACGCCGGCGGATGCCGAAGAGCTTGTCGCTG
CGCTCGATCAGGGTTCGTGCAACGTGCAGCAATGTAACCTGAACCATCCTTTCTTCACTC
GCCAGTATCCGATAGTCCTGCGTCACAGTGGTCGCATTAATCCCGAACGCATCGAGGACT
ATATCGCTGCGGGTGGCTACCGTATGCTCTACCACGTCATTCACGATCTGACACCGGCTG
AGGTGATTCAGATGATTACGCGCAGTGGTCTGCGTGGACGTGGTGGGGCCGGCTATCCAA
CCGGGCTTAAGTGGGCCACTGTTGCCAAAAGCCCCGGTGAGCGGAAGTTTGTGATTTGCA
ATGCCGATGAAGGTGATCCCGGTGCCTTTATGGATCGCAGCGTGCTTGAGAGCGATCCGC
ATCTGGTGCTGGAAGGAATGGCAATCGCAGCCTACGCAGTCGGCGCCGAGCAAGGCTTTA
TTTATGTGCGCGGAGAGTATCCGCTGGCAATCGAACGCCTGCAAAAAGCGATAGTGCAGG
CGCGACGGTTAGGTCTCCTCGGTGCCCAGATTTTTGAGAGTGGTTTCAACTTTCGGGTTG
ATATTCGCGTTGGTGCAGGGGCCTTTGTGTGTGGCGAAGAGACGGCCCTGATTGCCTCGA
TTGAAGGTCGGCGCGGCCAACCCCGGCCACGTCCGCCGTATCCGGCAGAGAGTGGTCTGT
GGGGAATGCCAACTCTGATCAACAACGTTGAGACCTTTGCCAACATTTCGGCCATTATCG
AGCACGGCCCGGAATGGTTTCGCCAGATTGGTACCGAACAAAGCAAAGGAACAAAGGTCT
TTGCATTGACCGGTAAGATTCGCAACACCGGTTTAATCGAGGTGCCGATGGGGATCACGC
TCCGCGAGATTGTCGAAGACATTGGTGATGGTACCCCCGATGGAACCCCGGTCAAGGCAG
TACAAACCGGTGGCCCGTCAGGTGGCTGCATTCCGGCCAGCCTGTTTGATACGCCGGTTG
ATTATGAATCGCTGGCAGCGGTCGGCTCGATTATGGGGTCGGGTGGGATGGTCGTGATGG
ACGAGCACACGAACATGGTTGATGTCGCTCGTTTCTATATGGAGTTTTGCAAAGATGAGT
CGTGCGGTAAGTGCATCCCATGTCGGGTAGGAACTGTCCAGCTCTTCAATCTACTCACCA
AATTGCGCAATGGACAGGCCGGCGAGAGTGATTTGCAAACGATTGAAGCATTATGCGAAC
TGATGCGTGAAACAAGCCTCTGTGGCCTGGGCCAATCAGCGCCAAACCCGGTACTTAGCA
CCCTACACTACTTCCGACACGAATACGAACAGCTCATCGGAGCGGAGGTTGATCATGGCG
GCTAACAGTAAAGGTGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Tested_Not_Purified
SolubleProtein: Not_Applicable
Find experimental protocols in NYSGRC-013057
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pNIC28-Bsa4

pNIC28-Bsa4 in advanced viewed

Synonyms: pSEC-His
Sequencing Primer: Forward:  pLICf
Reverse:  pLIC rev
Description: Bacterial expression vector with T7 promoter and N-terminal 6xHis tag with TEV protease cleavage site; kanamycin resistance in bacteria; ligation independent cloning
Comments: pET expression vector with His6 tag in 22-aa N-terminal fusion peptide, with TEV protease cleavage site. Includes sites for LIC cloning, and a “stuffer” fragment that includes the SacB gene, allowing negative selection on 5% sucrose
Size (bp): 7284
Parent Vector: None
Empty Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Opher Gileadi
Publications: PMID: 20541610
Title: High-throughput production of human proteins for crystallization: the SGC experience

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin f1 f1 origin 2266 2721
bacterial origin ColE ColE1 pBR322 origin 4338 4338
ligation independent cloning 3'LIC 2036 2050
ligation independent cloning 5'LIC 96 110
primer pLICrev pLIC reverse sequencing primer AGCAGCCAACTCAGCTTCC 2145 2164
primer pLICfor pLIC forward sequencing primer TGTGAGCGGATAACAATTCC 7262 7282
promoter T7 T7 promoter 7238 7254
protease cleavage site TEV TEV protease cleavage site 87 110
repressor binding site lac operator lac operator 7257 7281
repressor protein gene LacI Lac repressor gene 5772 6851
selectable marker KanR kanamycin resistance 2817 3629
selectable marker SacB SacB gene - allows for negative selection on 5% sucrose 569 1987
tag His N-terminal 6xHis tag 45 62
trxn termination sequence T7 term T7 terminator 2183 2229

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : Caur_1185
GENEID : 5825988
Locus Tag : Caur_1185
GI : 163668049
GenBank Accession : ABY34415.1
Target GenBank: None

 

Clone

Cloning Information : 594674
Original Clone ID : 013057

Experimental

TargetTrack - Experimental data : NYSGRC-013057

Organism


TAX_ID : 324602
Species Specific ID: 5825988

Reagents

Labome : Caur_1185-cDNA