DNASU Plasmid Repository • 480.965.5697 | Email

Dde_2494 (Desulfovibrio alaskensis G20) in pSpeedET (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Dde_2494
Gene Name:  Fic family protein
Sequence             
Original Clone ID: 31252
Keyword: full-length cds
Species: Desulfovibrio alaskensis G20
Type: cDNA
Vector Name: pSpeedET               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
Joint Center for Structural Genomics
DdCD00531343

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1029nts         Open reading frame : 51 to 1079

CTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGCATGATCAAGC
CCTCCAACTACCAGCCACCCTACACCATTACCCCGGCGATAGTGAATCTGGTCGCCGAGA
TAGGCGAGATCATCGGCCGCTACACCGTGCTGGCCGAACAGAACCTGACGCCGCGCCTGC
GCCGGGAGAACCGCATCCGTACCATCCAGGCCTCGCTGGCCATTGAGAACAATACGCTCA
CCCTTGAACAGGTGACCGCCGTGATCGATGGCAAACGGGTGTTGGGTCACCCCCGCGAGA
TTCAGGAGGTGCGTAACGCCTTTGCGACCTACGAGGCCATGGAGGACTGGGACGCCAGTG
TCGAGGGGGATTTGCTGGCGGCACACGAGTTGTTGATGCGTGGGCTGGTGGATGAAACGG
GTCGATATCGATCCGGCGGGGTCGGCATCTTCCGGGGAGAGCAGTTAGTTCACATGGCTC
CTCCTGCTGATCGTGTGCCCAAGCTTATGGCGGATCTCCTGGATTGGCTGGAAAACACCA
ACGAGCATCCCTTGGTGGCCAGTTGCATTTTTCACTACGAGTTCGAATTCATCCACCCCT
TTGCCGACGGTAACGGCCGCATGGGTCGGTTGTGGCAAACCCTGATTCTACGAAACTGGA
AGCCGCTGCTGGCCTACCTGCCGGTGGAGACAGTGATCCGTGATCGCCAGGAAGATTATT
ACCGGGTACTCGCGGTCGCCGACAGCCAAGCGGATGCCACTCCTTTTGTCGAGTTCATGT
TGGGGGCGTTGCGCGATGCCGTGCGCGAGGCTGTGTCGACCGACCATGTAGGCGACCAAG
TAACCGACCAAGTAGCGGCGTTGATCCGTGCGATTGGGGGCGGTGAGCTGAGCAGCAACG
ATTTGATGCAGGCTTTAGGTTTGTCACACCGGCCCACGTTCCGTAACAACTACCTCAACC
CGGCCATGGAAGACGAATGGATCGAACGTACCCAACCCGATTCCCCGCGCAGCCCGACTC
AGCGCTATCGGTTGACCGGTAAAGGCCAGCGTTGGCTGCAACCCCATGCCGACGAGTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a1013c,H338P
                                

5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGC

3' Linker Sequence:
CGCGACTTAATTAAACGGTCTCCAGCTTGGCTGTTTTGGCGGATGAG

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 374857
Recommended expression in: HK100
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSpeedET

pSpeedET in advanced viewed

Synonyms: pSpeed-ET
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHHENLYFQG tag; kanamycin resistance; PIPE cloning.
Comments: If this vector contains an insert, the ccdB death cassette will not be present.
Size (bp): 5464
Parent Vector: None
Empty Vector: EvNO00285791
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: PMID: 18004753
Title: Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type origin of replication 3306 3988
inducible trxn activator protein gene araC araC coding sequence 4563 5438
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 1596 1805
promoter araC araC promoter 256 285
promoter T7 T7 promoter 290 310
protease cleavage site TEV TEV protease cleavage site 382 402
selectable marker CmR chloramphenicol resistance gene (CmR) (lost in with-insert form) 502 1158
selectable marker KanR kanamycin resistance gene 2396 3208
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn termination sequence rrnB rrnB T2 transcription terminator 2258 2284

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : Dde_2494
GENEID : 3757511
Locus Tag : Dde_2494
GI : 78357537
GenBank Accession : YP_388986
Target GenBank: None

 

Protein

Structural Annotation Wiki : 374857

Clone

Cloning Information : 358167
HIP Master Clone ID : 287653
Original Clone ID : 31252

Experimental

TargetTrack - Experimental data : 374857

Organism


TAX_ID : 207559
Species Specific ID: 3757511

Reagents

Labome : Dde_2494-cDNA