DNASU Plasmid Repository • 480.965.5697 | Email

PPEF1 (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PPEF1
Gene Name:  protein phosphatase, EF-hand calcium binding domain 1
Sequence             
Original Clone ID: 8743a4BCt11p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00533608

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1389nts         Open reading frame : 1 to 1389
Reference Sequence Alignment

ACCCGTCGCAGCGATACGTCTCTGCGTGCGGCCTTAATTATCCTTAATTGGTATCGGGGC
TACAAAGCACGCTTGAAGGCTAGACAACATTATGCGCTTACTATATTTCAGAGTATTGAA
TACGCCGACGAGCAAGGTCAGATGCAGCTCTCAACATTCTTTTCCTTCATGCTGGAAAAC
TATACCCACATCCATAAAGAGGAACTGGAATTACGAAATCAATCGTTGGAGAGCGAACAG
GATATGCGTGACCGCTGGGATTACGTGGACTCTATTGATGTTCCGGATAGTTATAACGGG
CCACGGCTTCAATTTCCTCTGACGTGCACTGACATCGATCTCCTGTTAGAGGCATTCAAA
GAACAGCAGATACTGCACGCTCATTACGTCTTGGAAGTACTTTTTGAGACAAAGAAAGTG
CTGAAACAAATGCCCAATTTCACCCACATTCAGACGTCACCGTCCAAGGAAGTTACCATC
TGTGGAGACCTCCATGGCAAATTAGATGACCTGTTTTTGATTTTCTATAAAAACGGTCTT
CCATCGGAGCGTAATCCTTATGTCTTTAACGGGGATTTTGTAGATCGCGGAAAGAATAGC
ATAGAAATCCTGATGATTTTATGCGTGTCTTTCCTGGTTTACCCGAACGACCTCCACCTG
AATAGAGGCAACCATGAAGATTTTATGATGAATTTGCGATATGGTTTCACTAAAGAGATC
CTTCCAAAAATCAAGCTGCATGGCAAACGTATTTTACAAATACTGGAAGAGTTTTATGCG
TGGCTCCCCATCGGTACAATTGTCGACAACGAAATATTGGTGATCCACGGGGGAATTAGT
GAAACGACCGTTCGGATTCTTTTACATCGCGTAGAGCGGGCCAAAATGAAGTCAGTTCTG
ATTCCGCCAACTGAAACAAATGGTGATCATGACCCGGATTCCAAACACAACAAAGTGGGC
GTCACGTTCAATGCCCATGGTCGCATCAAGACCAACGGCTCGCCTACTGAACACCGGACA
GAGCATGAATGGGAGCAGATTATAGACATCCTCTGGAGCGATCCGCGTGGTAAAAATGGG
TGTTTTCCCAACACGTGCCGCGGAGGCGGTTGTTACTTCGGGCCAGACGTTACCTCTAAA
ATTTTGAATAAGTATCAGCTTAAAATGTTAATCAGAAGTCACGAATGCAAACCAGAAGGC
TACGAGATTTGTCATGATGGTAAGGTAGTGACTATATTTTCAGCATCCAACTATTATGAA
GAGGGAAGCAATCGAGGCGCTTACATCAAACTGTGCTCGGGTACAAAACCTCGGTTCTTT
CAATATCAGGTCACCAAAGCGACTTGTTTTCAACCGCTGCGTGAAGGGCATCATCACCAT
CACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a44t,g45t,Q15L
                                

5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in NYSGXRC-8743a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PPEF1
Symbol Nomenclature : PPEF1
SYNONYM : PP7; PPEF; PPP7C; PPP7CA
Designation : protein phosphatase 7, catalytic subunit, alpha isozyme|protein phosphatase with EF calcium-binding domain|protein phosphatase, serine/threonine type, with EF-hands|serine/threonine protein phosphatase 7|serine/threonine-protein phosphatase 7|serine/threonine-protein phosphatase with EF-hands 1
Full Nomenclature : protein phosphatase, EF-hand calcium binding domain 1
GENEID : 5475
Locus Tag : RP3-499B10.1
GI : 23312380
GenBank Accession : NM_006240
HGNC : 9243
MIM : 300109
Vega : OTTHUMG00000021219
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00533608        ---------------------------ACCCGTCGCAGCGATACGTCTCTGCGTGCGGCC
XM_005274554.1      ------------------------------------------------------------
NM_006240.2         ATGGGATGCAGCAGTTCTTCAACGAAAACCAGGAGATCTGACACATCACTGAGAGCTGCG
NM_152224.1         ATGGGATGCAGCAGTTCTTCAACGAAAACCAGGAGATCTGACACATCACTGAGAGCTGCG
XM_005274553.1      ATGGGATGCAGCAGTTCTTCAACGAAAACCAGGAGATCTGACACATCACTGAGAGCTGCG
NM_152226.1         ATGGGATGCAGCAGTTCTTCAACGAAAACCAGGAGATCTGACACATCACTGAGAGCTGCG
                                                                                

HsCD00533608        TTAATTATCCTTAATTGGTATCGGGGCTACAAAGCACGCTTGAAGGCTAGACAACATTAT
XM_005274554.1      ------------------------------------------------------------
NM_006240.2         TTGATCATCCAGAACTGGTACCGAGGTTACAAAGCTCGACTGAAGGCCAGACAACACTAT
NM_152224.1         TTGATCATCCAGAACTGGTACCGAGGTTACAAAGCTCGACTGAAGGCCAGACAACACTAT
XM_005274553.1      TTGATCATCCAGAACTGGTACCGAGGTTACAAAGCTCGACTGAAGGCCAGACAACACTAT
NM_152226.1         TTGATCATCCAGAACTGGTACCGAGGTTACAAAGCTCGACTGAAGGCCAGACAACACTAT
                                                                                

HsCD00533608        GCGCTTACTATATTTCAGAGTATTGAATACGCCGACGAGCAAGGTCAGATGCAGCTCTCA
XM_005274554.1      ------------------------------------------------------------
NM_006240.2         GCCCTCACCATCTTCCAGTCCATCGAATATGCTGATGAACAAGGCCAAATGCAGTTATCC
NM_152224.1         GCCCTCACCATCTTCCAGTCCATCGAATATGCTGATGAACAAGGCCAAATGCAGTTATCC
XM_005274553.1      GCCCTCACCATCTTCCAGTCCATCGAATATGCTGATGAACAAGGCCAAATGCAGTTATCC
NM_152226.1         GCCCTCACCATCTTCCAGTCCATCGAATATGCTGATGAACAAGGCCAAATGCAGTTATCC
                                                                                

HsCD00533608        ACATTCTTTTCCTTCATGCTGGAAAACTATACCCACATCCATAAAGAGGAACTGGAATTA
XM_005274554.1      ---------------ATGTTGGAAAACTACACACATATACATAAGGAAGAGCTAGAATTA
NM_006240.2         ACCTTCTTTTCCTTCATGTTGGAAAACTACACACATATACATAAGGAAGAGCTAGAATTA
NM_152224.1         ACCTTCTTTTCCTTCATGTTGGAAAACTACACACATATACATAAGGAAGAGCTAGAATTA
XM_005274553.1      ACCTTCTTTTCCTTCATGTTGGAAAACTACACACATATACATAAGGAAGAGCTAGAATTA
NM_152226.1         ACCTTCTTTTCCTTCATGTTGGAAAACTACACACATATACATAAGGAAGAGCTAGAATTA
                                   *** ********** **.** **.*****.**.**.**.******

HsCD00533608        CGAAATCAATCGTTGGAGAGCGAACAGGATATGCGTGACCGCTGGGATTACGTGGACTCT
XM_005274554.1      AGAAATCAGTCTCTTGAAAGCGAACAGGACATGAGGGATAGATGGGATTATGTGGACTCG
NM_006240.2         AGAAATCAGTCTCTTGAAAGCGAACAGGACATGAGGGATAGATGGGATTATGTGGACTCG
NM_152224.1         AGAAATCAGTCTCTTGAAAGCGAACAGGACATGAGGGATAGATGGGATTATGTGGACTCG
XM_005274553.1      AGAAATCAGTCTCTTGAAAGCGAACAGGACATGAGGGATAGATGGGATTATGTGGACTCG
NM_152226.1         AGAAATCAGTCTCTTGAAAGCGAACAGGACATGAGGGATAGATGGGATTATGTGGACTCG
                    .*******.**  * **.*********** ***.* ** .*.******** ******** 

HsCD00533608        ATTGATGTTCCGGATAGTTATAACGGGCCACGGCTTCAATTTCCTCTGACGTGCACTGAC
XM_005274554.1      ATAGATGTCCCAGACTCCTATAATGGTCCTCGGCTACAATTTCCTCTCACTTGTACGGAT
NM_006240.2         ATAGATGTCCCAGACTCCTATAATGGTCCTCGGCTACAATTTCCTCTCACTTGTACGGAT
NM_152224.1         ATAGATGTCCCAGACTCCTATAATGGTCCTCGGCTACAATTTCCTCTCACTTGTACGGAT
XM_005274553.1      ATAGATGTCCCAGACTCCTATAATGGTCCTCGGCTACAATTTCCTCTCACTTGTACGGAT
NM_152226.1         ATAGATGTCCCAGACTCCTATAATGGTCCTCGGCTACAATTTCCTCTCACTTGTACGGAT
                    **:***** **.** :  ***** ** **:*****:*********** ** ** ** ** 

HsCD00533608        ATCGATCTCCTGTTAGAGGCATTCAAAGAACAGCAGATACTGCACGCTCATTACGTCTTG
XM_005274554.1      ATTGATTTACTTCTTGAGGCCTTCAAGGAACAACAGATACTTCATGCCCATTATGTCTTA
NM_006240.2         ATTGATTTACTTCTTGAGGCCTTCAAGGAACAACAGATACTTCATGCCCATTATGTCTTA
NM_152224.1         ATTGATTTACTTCTTGAGGCCTTCAAGGAACAACAGATACTTCATGCCCATTATGTCTTA
XM_005274553.1      ATTGATTTACTTCTTGAGGCCTTCAAGGAACAACAGATACTTCATGCCCATTATGTCTTA
NM_152226.1         ATTGATTTACTTCTTGAGGCCTTCAAGGAACAACAGATACTTCATGCCCATTATGTCTTA
                    ** *** *.**  *:*****.*****.*****.******** ** ** ***** *****.

HsCD00533608        GAAGTACTTTTTGAGACAAAGAAAGTGCTGAAACAAATGCCCAATTTCACCCACATTCAG
XM_005274554.1      GAGGTGCTATTTGAAACCAAGAAAGTCCTGAAGCAAATGCCGAATTTCACTCACATACAA
NM_006240.2         GAGGTGCTATTTGAAACCAAGAAAGTCCTGAAGCAAATGCCGAATTTCACTCACATACAA
NM_152224.1         GAGGTGCTATTTGAAACCAAGAAAGTCCTGAAGCAAATGCCGAATTTCACTCACATACAA
XM_005274553.1      GAGGTGCTATTTGAAACCAAGAAAGTCCTGAAGCAAATGCCGAATTTCACTCACATACAA
NM_152226.1         GAGGTGCTATTTGAAACCAAGAAAGTCCTGAAGCAAATGCCGAATTTCACTCACATACAA
                    **.**.**:*****.**.******** *****.******** ******** *****:**.

HsCD00533608        ACGTCACCGTCCAAGGAAGTTACCATCTGTGGAGACCTCCATGGCAAATTAGATGACCTG
XM_005274554.1      ACTTCTCCCTCCAAAGAGGTAACAATCTGTGGTGATTTGCATGGGAAACTGGATGATCTT
NM_006240.2         ACTTCTCCCTCCAAAGAGGTAACAATCTGTGGTGATTTGCATGGGAAACTGGATGATCTT
NM_152224.1         ACTTCTCCCTCCAAAGAGGTAACAATCTGTGGTGATTTGCATGGGAAACTGGATGATCTT
XM_005274553.1      ACTTCTCCCTCCAAAGAGGTAACAATCTGTGGTGATTTGCATGGGAAACTGGATGATCTT
NM_152226.1         ACTTCTCCCTCCAAAGAGGTAACAATCTGTGGTGATTTGCATGGGAAACTGGATGATCTT
                    ** **:** *****.**.**:**.********:**  * ***** *** *.***** ** 

HsCD00533608        TTTTTGATTTTCTATAAAAACGGTCTTCCATCGGAGCGTAATCCTTATGTCTTTAACGGG
XM_005274554.1      TTTTTGATCTTCTACAAGAATGGTCTCCCCTCAGAGAGGAACCCGTATGTTTTTAATGGT
NM_006240.2         TTTTTGATCTTCTACAAGAATGGTCTCCCCTCAGAGAGGAACCCGTATGTTTTTAATGGT
NM_152224.1         TTTTTGATCTTCTACAAGAATGGTCTCCCCTCAGAGAGGAACCCGTATGTTTTTAATGGT
XM_005274553.1      TTTTTGATCTTCTACAAGAATGGTCTCCCCTCAGAGAGGAACCCGTATGTTTTTAATGGT
NM_152226.1         TTTTTGATCTTCTACAAGAATGGTCTCCCCTCAGAGAGGAACCCGTATGTTTTTAATGGT
                    ******** ***** **.** ***** **.**.***.* ** ** ***** ***** ** 

HsCD00533608        GATTTTGTAGATCGCGGAAAGAATAGCATAGAAATCCTGATGATTTTATGCGTGTCTTTC
XM_005274554.1      GACTTTGTAGATCGAGGAAAGAATTCCATAGAGATCCTAATGATCCTGTGTGTGAGTTTT
NM_006240.2         GACTTTGTAGATCGAGGAAAGAATTCCATAGAGATCCTAATGATCCTGTGTGTGAGTTTT
NM_152224.1         GACTTTGTAGATCGAGGAAAGAATTCCATAGAGATCCTAATGATCCTGTGTGTGAGTTTT
XM_005274553.1      GACTTTGTAGATCGAGGAAAGAATTCCATAGAGATCCTAATGATCCTGTGTGTGAGTTTT
NM_152226.1         GACTTTGTAGATCGAGGAAAGAATTCCATAGAGATCCTAATGATCCTGTGTGTGAGTTTT
                    ** ***********.*********: ******.*****.*****  *.** ***: *** 

HsCD00533608        CTGGTTTACCCGAACGACCTCCACCTGAATAGAGGCAACCATGAAGATTTTATGATGAAT
XM_005274554.1      CTTGTCTACCCCAATGACCTGCACTTGAACAGAGGGAACCACGAAGATTTTATGATGAAT
NM_006240.2         CTTGTCTACCCCAATGACCTGCACTTGAACAGAGGGAACCACGAAGATTTTATGATGAAT
NM_152224.1         CTTGTCTACCCCAATGACCTGCACTTGAACAGAGGGAACCACGAAGATTTTATGATGAAT
XM_005274553.1      CTTGTCTACCCCAATGACCTGCACTTGAACAGAGGGAACCACGAAGATTTTATGATGAAT
NM_152226.1         CTTGTCTACCCCAATGACCTGCACTTGAACAGAGGGAACCACGAAGATTTTATGATGAAT
                    ** ** ***** ** ***** *** **** ***** ***** ******************

HsCD00533608        TTGCGATATGGTTTCACTAAAGAGATCCTTCCAAAAATCAAGCTGCATGGCAAACGTATT
XM_005274554.1      CTGAGGTATGGCTTCACGAAAGAAATTTTGCATAAATATAAGCTACATGGAAAAAGAATC
NM_006240.2         CTGAGGTATGGCTTCACGAAAGAAATTTTGCATAAATATAAGCTACATGGAAAAAGAATC
NM_152224.1         CTGAGGTATGGCTTCACGAAAGAAATTTTGCATAAATATAAGCTACATGGAAAAAGAATC
XM_005274553.1      CTGAGGTATGGCTTCACGAAAGAAATTTTGCATAAATATAAGCTACATGGAAAAAGAATC
NM_152226.1         CTGAGGTATGGCTTCACGAAAGAAATTTTGCATAAATATAAGCTACATGGAAAAAGAATC
                     **.*.***** ***** *****.**  * *.:***:: *****.*****.***.*:** 

HsCD00533608        TTACAAATACTGGAAGAGTTTTATGCGTGGCTCCCCATCGGTACAATTGTCGACAACGAA
XM_005274554.1      TTACAAATCTTGGAAGAATTCTATGCCTGGCTCCCAATCGGTACAATCGTTGACAATGAA
NM_006240.2         TTACAAATCTTGGAAGAATTCTATGCCTGGCTCCCAATCGGTACAATCGTTGACAATGAA
NM_152224.1         TTACAAATCTTGGAAGAATTCTATGCCTGGCTCCCAATCGGTACAATCGTTGACAATGAA
XM_005274553.1      TTACAAATCTTGGAAGAATTCTATGCCTGGCTCCCAATCGGTACAATCGTTGACAATGAA
NM_152226.1         TTACAAATCTTGGAAGAATTCTATGCCTGGCTCCCAATCGGTACAATCGTTGACAATGAA
                    ********. *******.** ***** ********.*********** ** ***** ***

HsCD00533608        ATATTGGTGATCCACGGGGGAATTAGTGAAACGACCGTTCGGATTCTTTTACATCGCGTA
XM_005274554.1      ATCCTGGTCATCCATGGTGGGATATCAGAGACCACAGACTTGAATTTACTCCACCGTGTA
NM_006240.2         ATCCTGGTCATCCATGGTGGGATATCAGAGACCACAGACTTGAATTTACTCCACCGTGTA
NM_152224.1         ATCCTGGTCATCCATGGTGGGATATCAGAGACCACAGACTTGAATTTACTCCACCGTGTA
XM_005274553.1      ATCCTGGTCATCCATGGTGGGATATCAGAGACCACAGACTTGAATTTACTCCACCGTGTA
NM_152226.1         ATCCTGGTCATCCATGGTGGGATATCAGAGACCACAGACTTGAATTTACTCCACCGTGTA
                    **. **** ***** ** **.**:: :**.** **.*:   **:* *: *.** ** ***

HsCD00533608        GAGCGGGCCAAAATGAAGTCAGTTCTGATTCCGCCAACTGAAACAAATGGTGATCATGAC
XM_005274554.1      GAGAGGAACAAGATGAAATCTGTGCTGATACCACCAACGGAAACAAACAGAGACCATGAC
NM_006240.2         GAGAGGAACAAGATGAAATCTGTGCTGATACCACCAACGGAAACAAACAGAGACCATGAC
NM_152224.1         GAGAGGAACAAGATGAAATCTGTGCTGATACCACCAACGGAAACAAACAGAGACCATGAC
XM_005274553.1      GAGAGGAACAAGATGAAATCTGTGCTGATACCACCAACGGAAACAAACAGAGACCATGAC
NM_152226.1         GAGAGGAACAAGATGAAATCTGTGCTGATACCACCAACGGAAACAAACAGAGACCATGAC
                    ***.**..***.*****.**:** *****:**.***** ******** .*:** ******

HsCD00533608        CCGGATTCCAAACACAACAAAGTGGGCGTCACGTTCAATGCCCATGGTCGCATCAAGACC
XM_005274554.1      ACTGACTCGAAGCACAATAAAGTAGGTGTGACTTTTAATGCACATGGAAGAATCAAAACA
NM_006240.2         ACTGACTCGAAGCACAATAAAGTAGGTGTGACTTTTAATGCACATGGAAGAATCAAAACA
NM_152224.1         ACTGACTCGAAGCACAATAAAATTATTGATATTCTGTGGAGTGATCCCAGAGGCAAAAAT
XM_005274553.1      ACTGACTCGAAGCACAATAAAGTAGGTGTGACTTTTAATGCACATGGAAGAATCAAAACA
NM_152226.1         ACTGACTCGAAGCACAATAAAGTAGGTGTGACTTTTAATGCACATGGAAGAATCAAAACA
                    .* ** ** **.***** ***.* .  *: *   * :. .   **   .*.. ***.*. 

HsCD00533608        AACGGCTCGCCTACTGAACACCGGACAGAG------------------------------
XM_005274554.1      AATGGATCTCCTACTGAACACTTAACAGAGCATGAATGGGAACAGATTATTGATATTCTG
NM_006240.2         AATGGATCTCCTACTGAACACTTAACAGAGCATGAATGGGAACAGATTATTGATATTCTG
NM_152224.1         GGCTGTTTTCCAAATACGTGCCGAGGAGGGGGCTGCT-----------------------
XM_005274553.1      AATGGATCTCCTACTGAACACTTAACAGAGCATGAATGGGAACAGATTATTGATATTCTG
NM_152226.1         AATGGATCTCCTACTGAACACTTAACAGAGCATG--------------------------
                    ..  * *  **:*.*... .*  .. **.*                              

HsCD00533608        ------------------------------------------------------------
XM_005274554.1      TGGAGTGATCCCAGAGGCAAAAATGGCTGTTTTCCAAATACGTGCCGAGGAGGGGGCTGC
NM_006240.2         TGGAGTGATCCCAGAGGCAAAAATGGCTGTTTTCCAAATACGTGCCGAGGAGGGGGCTGC
NM_152224.1         ------------------------------------------------------------
XM_005274553.1      TGGAGTGATCCCAGAGGCAAAAATGGCTGTTTTCCAAATACGTGCCGAGGAGGGGGCTGC
NM_152226.1         ------------------------------------------------------------
                                                                                

HsCD00533608        ------------------------------------------------------------
XM_005274554.1      TATTTTGGACCAGATGTTACTTCCAAGATTCTTAATAAATACCAGTTGAAGATGCTCATC
NM_006240.2         TATTTTGGACCAGATGTTACTTCCAAGATTCTTAATAAATACCAGTTGAAGATGCTCATC
NM_152224.1         -ATTTTGGACCAGATGTTACTTCCAAGATTCTTAATAAATACCAGTTGAAGATGCTCATC
XM_005274553.1      TATTTTGGACCAGATGTTACTTCCAAGATTCTTAATAAATACCAGTTGAAGATGCTCATC
NM_152226.1         ------------------------------------------------------------
                                                                                

HsCD00533608        ------------------------------------------------------------
XM_005274554.1      AGGTCTCATGAATGTAAGCCCGAAGGGTATGAAATCTGTCATGATGGGAAGGTGGTGACT
NM_006240.2         AGGTCTCATGAATGTAAGCCCGAAGGGTATGAAATCTGTCATGATGGGAAGGTGGTGACT
NM_152224.1         AGGTCTCATGAATGTAAGCCCGAAGGGTATGAAATCTGTCATGATGGGAAGGTGGTGACT
XM_005274553.1      AGGTCTCATGAATGTAAGCCCGAAGGGTATGAAATCTGTCATGATGGGAAGGTGGTGACT
NM_152226.1         ----------------------------------------AATGGGAACAGGTGGTGACT
                                                                                

HsCD00533608        ----------------------------------------------------------CA
XM_005274554.1      ATATTTTCTGCTTCTAATTATTATGAAGAAGGCAGCAATCGAGGAGCTTACATCAAACTA
NM_006240.2         ATATTTTCTGCTTCTAATTATTATGAAGAAGGCAGCAATCGAGGAGCTTACATCAAACTA
NM_152224.1         ATATTTTCTGCTTCTAATTATTATGAAGAAGGCAGCAATCGAGGAGCTTACATCAAACTA
XM_005274553.1      ATATTTTCTGCTTCTAATTATTATGAAGAAGGCAGCAATCGAGGAGCTTACATCAAACTA
NM_152226.1         ATATTTTCTGCTTCTAATTATTATGAAGAAGGCAGCAATCGAGGAGCTTACATCAAACTA
                                                                               *

HsCD00533608        TGAATGGGAGCAGATTATAGACATCCTCTGGAGCGATCCGCGTGGTAAAAATGGGTGTTT
XM_005274554.1      TGTTCTGGTACAACTCCTCGATTTTTCCAGTACCAAGTAACTAAAGCAACGTGCTTTCAG
NM_006240.2         TGTTCTGGTACAACTCCTCGATTTTTCCAGTACCAAGTAACTAAAGCAACGTGCTTTCAG
NM_152224.1         TGTTCTGGTACAACTCCTCGATTTTTCCAGTACCAAGTAACTAAAGCAACGTGCTTTCAG
XM_005274553.1      TGTTCTGGTACAACTCCTCGATTTTTCCAGTACCAAGTAACTAAAGCAACGTGCTTTCAG
NM_152226.1         TGTTCTGGTACAACTCCTCGATTTTTCCAGTACCAAGTAACTAAAGCAACGTGCTTTCAG
                    **::  **:.**..* .*.** :*   *:* * *.*  ..* :.. .**..**  *  : 

HsCD00533608        TCCCAACACGTGCCGCGGAGGCGGTTGTTACTTCGGGCCAGACGTTACCTCTAAAATTTT
XM_005274554.1      CCTCTTCGCCAAAGAGTGGATACTATGGAAAACAGCGCCATCAAGATATTAAGAGAGAGA
NM_006240.2         CCTCTTCGCCAAAGAGTGGATACTATGGAAAACAGCGCCATCAAGATATTAAGAGAGAGA
NM_152224.1         CCTCTTCGCCAAAGAGTGGATACTATGGAAAACAGCGCCATCAAGATATTAAGAGAGAGA
XM_005274553.1      CCTCTTCGCCAAAGAGTGGATACTATGGAAAACAGCGCCATCAAGATATTAAGAGAGAGA
NM_152226.1         CCTCTTCGCCAAAGAGTGGATACTATGGAAAACAGCGCCATCAAGATATTAAGAGAGAGA
                     * *::*.* :.. .  *.. .  :** :*.: .* **** ... ::. *.:.*.* : :

HsCD00533608        GAATAAGTATCAGCTTAAAATGTTAATCAGAAGTCACGAATGCAAACCAGAAGGCTACGA
XM_005274554.1      GTGATTTCACGAAAAAGTGACCTTACTCGTGCTTTCCAACTTCAAGACCACAGAAAATCA
NM_006240.2         GTGATTTCACGAAAAAGTGACCTTACTCGTGCTTTCCAACTTCAAGACCACAGAAAATCA
NM_152224.1         GTGATTTCACGAAAAAGTGACCTTACTCGTGCTTTCCAACTTCAAGACCACAGAAAATCA
XM_005274553.1      GTGATTTCACGAAAAAGTGACCTTACTCGTGCTTTCCAACTTCAAGACCACAGAAAATCA
NM_152226.1         GTGATTTCACGAAAAAGTGACCTTACTCGTGCTTTCCAACTTCAAGACCACAGAAAATCA
                    *:.:::  *  *..::.:.*  ***.**. .. * .*.*.* ***..*...**..:*  *

HsCD00533608        G-------------------------ATTTGTCATGATGGTAAGGTAGTGACTATATTTT
XM_005274554.1      GGAAAACTTTCTGTGAGCCAGTGGGCTTTTTGCATGGAGAACATTTTGGGGCTGAACTTA
NM_006240.2         GGAAAACTTTCTGTGAGCCAGTGGGCTTTTTGCATGGAGAACATTTTGGGGCTGAACTTA
NM_152224.1         GGAAAACTTTCTGTGAGCCAGTGGGCTTTTTGCATGGAGAACATTTTGGGGCTGAACTTA
XM_005274553.1      GGAAAACTTTCTGTGAGCCAGTGGGCTTTTTGCATGGAGAACATTTTGGGGCTGAACTTA
NM_152226.1         GGAAAACTTTCTGTGAGCCAGTGGGCTTTTTGCATGGAGAACATTTTGGGGCTGAACTTA
                    *                         :***  ****.:*.:.*  *:* *.**.:* **:

HsCD00533608        CAGCATCCAACTATTATGAAGAGGGAAGCAATCGAGGCGCTTACATCAAACTGTGCTCGG
XM_005274554.1      CCATGGAGATCCCTCAGTTCGAATCTGGTAAACATAGACCAAAATGGAAACGTTGAATAC
NM_006240.2         CCATGGAGATCCCTCAGTTCGAATCTGGTAAACATAGACCAAAATGGAAACGTTGAATAC
NM_152224.1         CCATGGAGATCCCTCAGTTCGAATCTGGTAAACATAGACCAAAATGGAAACGTTGAATAC
XM_005274553.1      CCATGGAGATCCCTCAGTTCGAATCTGGTAAACATAGACCAAAATGGAAACGTTGAATAC
NM_152226.1         CCATGGAGATCCCTCAGTTCGAATCTGGTAAACATAGACCAAAATGGAAACGTTGAATAC
                    *.. . . *:* .* *  :.**.  :.* **:*.:.*. *::*.:  ****  **.: . 

HsCD00533608        GTACAAAACCTCGGTTCTTTCAATATCAGGTCACCAAAGCGACTTGTTTTCAACCGCTGC
XM_005274554.1      ATGTCCAGCTTCCAGAATATCCGCATTGAAAAACCTGTACAAGAGGCTCATTCTACTCTA
NM_006240.2         ATGTCCAGCTTCCAGAATATCCGCATTGAAAAACCTGTACAAGAGGCTCATTCTACTCTA
NM_152224.1         ATGTCCAGCTTCCAGAATATCCGCATTGAAAAACCTGTACAAGAGGCTCATTCTACTCTA
XM_005274553.1      ATGTCCAGCTTCCAGAATATCCGCATTGAAAAACCTGTACAAGAGGCTCATTCTACTCTA
NM_152226.1         ATGTCCAGCTTCCAGAATATCCGCATTGAAAAACCTGTACAAGAGGCTCATTCTACTCTA
                    .*. ..*.* ** . :.*:**.. ** ...:.***:.:.*.* : * * : :. .    .

HsCD00533608        GTGAAGGGCATCATCACCATCACCACTGA-------------------------------
XM_005274554.1      GTTGAAACTCTGTACAGATACAGATCTGACCTGGAAATCATATTTAATGCCATTGACACT
NM_006240.2         GTTGAAACTCTGTACAGATACAGATCTGACCTGGAAATCATATTTAATGCCATTGACACT
NM_152224.1         GTTGAAACTCTGTACAGATACAGATCTGACCTGGAAATCATATTTAATGCCATTGACACT
XM_005274553.1      GTTGAAACTCTGTACAGATACAGATCTGACCTGGAAATCATATTTAATGCCATTGACACT
NM_152226.1         GTTGAAACTCTGTACAGATACAGATCTGACCTGGAAATCATATTTAATGCCATTGACACT
                    ** .*..  .* ::** .::** .:****                               

HsCD00533608        ------------------------------------------------------------
XM_005274554.1      GATCACTCAGGCCTGATCTCCGTGGAAGAATTTCGTGCCATGTGGAAACTTTTTAGTTCT
NM_006240.2         GATCACTCAGGCCTGATCTCCGTGGAAGAATTTCGTGCCATGTGGAAACTTTTTAGTTCT
NM_152224.1         GATCACTCAGGCCTGATCTCCGTGGAAGAATTTCGTGCCATGTGGAAACTTTTTAGTTCT
XM_005274553.1      GATCACTCAGGCCTGATCTCCGTGGAAGAATTTCGTGCCATGTGGAAACTTTTTAGTTCT
NM_152226.1         GATCACTCAGGCCTGATCTCCGTGGAAGAATTTCGTGCCATGTGGAAACTTTTTAGTTCT
                                                                                

HsCD00533608        ------------------------------------------------------------
XM_005274554.1      CACTACAATGTTCACATTGATGATTCCCAAGTCAATAAGCTTGCCAACATAATGGACTTG
NM_006240.2         CACTACAATGTTCACATTGATGATTCCCAAGTCAATAAGCTTGCCAACATAATGGACTTG
NM_152224.1         CACTACAATGTTCACATTGATGATTCCCAAGTCAATAAGCTTGCCAACATAATGGACTTG
XM_005274553.1      CACTACAATGTTCACATTGATGATTCCCAAGTCAATAAGCTTGCCAACATAATGGACTTG
NM_152226.1         CACTACAATGTTCACATTGATGATTCCCAAGTCAATAAGCTTGCCAACATAATGGACTTG
                                                                                

HsCD00533608        ------------------------------------------------------------
XM_005274554.1      AACAAAGATGGAAGCATTGACTTTAATGAGTTTTTAAAGGCTTTCTATGTAGTGCATAGA
NM_006240.2         AACAAAGATGGAAGCATTGACTTTAATGAGTTTTTAAAGGCTTTCTATGTAGTGCATAGA
NM_152224.1         AACAAAGATGGAAGCATTGACTTTAATGAGTTTTTAAAGGCTTTCTATGTAGTGCATAGA
XM_005274553.1      AACAAAGATGGAAGCATTGACTTTAATGAGTTTTTAAAGGCTTTCTATGTAGTGCATAGA
NM_152226.1         AACAAAGATGGAAGCATTGACTTTAATGAGTTTTTAAAGGCTTTCTATGTAGTGCATAGA
                                                                                

HsCD00533608        ------------------------------------------
XM_005274554.1      TATGAAGACTTGATGAAACCTGATGTCACCAACCTTGGCTAA
NM_006240.2         TATGAAGACTTGATGAAACCTGATGTCACCAACCTTGGCTAA
NM_152224.1         TATGAAGACTTGATGAAACCTGATGTCACCAACCTTGGCTAA
XM_005274553.1      TATGAAGACTTGATGAAACCTGATGTCACCAACCTTGGCTAA
NM_152226.1         TATGAAGACTTGATGAAACCTGATGTCACCAACCTTGGCTAA
                                                              

Pathways

Reactome : Disease
Reactome : Diseases associated with visual transduction
Reactome : Inactivation, recovery and regulation of the phototransduction cascade
Reactome : Signal Transduction
Reactome : The phototransduction cascade
Reactome : Visual phototransduction

Protein

SMART domain : PP2Ac : Protein phosphatase 2A homologues, catalytic domain.
Structural Annotation Wiki : NYSGXRC-8743a
HPRD : 02118

Clone

Cloning Information : 475834
HIP Master Clone ID : 397340
Original Clone ID : 8743a4BCt11p1

Experimental

TargetTrack - Experimental data : NYSGXRC-8743a

Organism


TAX_ID : 9606
Species Specific ID: 5475

Genome

Chromosome : X
Map Location : Xp22
Ensembl : ENSG00000086717

Reagents

Labome : PPEF1-antibody