DNASU Plasmid Repository • 480.965.5697 | Email

TAB1 (Homo sapiens) in pSGX4 (His and Smt3-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TAB1
Gene Name:  TGF-beta activated kinase 1/MAP3K7 binding protein 1
Sequence             
Original Clone ID: 8701a6BSt3p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX4               Format:  FUSION
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00533703

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 924nts         Open reading frame : 1 to 924
Reference Sequence Alignment

GGCTCAGCCTCCAACCGCAGCTACTCTGCTGATGGCAAGGGCACTGAGAGCCACCCGCCA
GAGGACAGCTGGCTCAAGTTCAGGAGTGAGAACAACTGCTTCCTGTATGGGGTCTTCAAC
GGCTATGATGGCAACCGAGTGACCAACTTCGTGGCCCAGCGGCTGTCCGCAGAGCTCCTG
CTGGGCCAGCTGAATGCCGAGCACGCCGAGGCCGATGTGCGGCGTGTGCTGCTGCAGGCC
TTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCCATTGACGACGCCTTGGCTGAGAAGGCA
AGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCTCAGCACCAGCTGCCTCCTCAGTATCAG
AAGATCCTTGAGAGACTCAAGACGTTAGAGAGGGAAATTTCGGGAGGGGCCATGGCCGTT
GTGGCGGTCCTTCTCAACAACAAGCTCTACGTCGCCAATGTCGGTACAAACCGTGCACTT
TTATGCAAATCGACAGTGGATGGGTTGCAGGTGACACAGCTGAACGTGGACCACACCACA
GAGAACGAGGATGAGCTCTTCCGTCTTTCGCAGCTGGGCTTGGATGCTGGAAAGATCAAG
CAGGTGGGGATCATCTGTGGGCAGGAGAGCACCCGGCGGATCGGGGATTACAAGGTTAAA
TATGGCTACACGGACATTGACCTTCTCAGCGCTGCCAAGTCCAAACCAATCATCGCAGAG
CCAGAAATCCATGGGGCACAGCCGCTGGATGGGGTGACGGGCTTCTTGGTGCTGATGTCG
GAGGGGTTGTACAAGGCCCTAGAGGCAGCCCATGGGCCTGGGCAGGCCAACCAGGAGATT
GCTGCGATGATTGACACTGAGTTTGCCAAGCAGACCTCCCTGGACGCAGTGGCCCAGGCC
GTCGTGGACCGGGTGAAGCGCTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAGAGAACAGATTGGTGGATCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Tested_Not_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-8701a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX4

pSGX4 in advanced viewed

Synonyms: pSGX-4, pSGX4_BS
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promotor, adds N-terminal 6xHis and smt-3 tags, cleavage site; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen. N-terminal 6xHis-tag followed by smt3 fusion protein. Smt3 fusion cloned into NheI and BamHI sites. TOPO adaptation at BamHI and XhoI sites.
Size (bp): 5611
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
TOPO recognition site TOPO TOPO cloning site 5435 5444
bacterial origin ColE ColE1 bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
protease cleavage site ULP site ULP cleavage site (recognizes the tertiary structure of SUMO) 5140 5140
repressor protein gene LacI lacI cds 3515 4351
ribosome binding site RBS ribosome binding site (RBS) 5062 5068
selectable marker KanR kanamycin resistance gene 563 1375
tag Smt3 Smt3 tag 5140 5424
tag His 6xHis tag 5083 5100
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 termination sequence 5539 5585

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TAB1
Symbol Nomenclature : TAB1
SYNONYM : 3'-Tab1; MAP3K7IP1
Designation : TAK1-binding protein 1|TGF-beta-activated kinase 1 and MAP3K7-binding protein 1|mitogen-activated protein kinase kinase kinase 7-interacting protein 1|transforming growth factor beta-activated kinase-binding protein 1
Full Nomenclature : TGF-beta activated kinase 1/MAP3K7 binding protein 1
GENEID : 10454
Locus Tag : RP3-407F17.2
GI : 41281798
GenBank Accession : NM_153497
HGNC : 18157
MIM : 602615
Vega : OTTHUMG00000151102
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00533703      ------------------------------------------------------------
NM_153497.2       ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGAC
NM_006116.2       ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGAC
                                                                              

HsCD00533703      ---------------------------GGCTCAGCCTCCAACCGCAGCTACTCTGCTGAT
NM_153497.2       CTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGAT
NM_006116.2       CTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGAT
                                             *********************************

HsCD00533703      GGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAAC
NM_153497.2       GGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAAC
NM_006116.2       GGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAAC
                  ************************************************************

HsCD00533703      AACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCAACTTCGTG
NM_153497.2       AACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCAACTTCGTG
NM_006116.2       AACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCAACTTCGTG
                  ************************************************************

HsCD00533703      GCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACGCCGAGGCC
NM_153497.2       GCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACGCCGAGGCC
NM_006116.2       GCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACGCCGAGGCC
                  ************************************************************

HsCD00533703      GATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCC
NM_153497.2       GATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCC
NM_006116.2       GATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCCTGGAGTCC
                  ************************************************************

HsCD00533703      ATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
NM_153497.2       ATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
NM_006116.2       ATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGAGTCCCT
                  ************************************************************

HsCD00533703      CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGG
NM_153497.2       CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGG
NM_006116.2       CAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGG
                  ************************************************************

HsCD00533703      GAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTC
NM_153497.2       GAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTC
NM_006116.2       GAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTC
                  ************************************************************

HsCD00533703      GCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTG
NM_153497.2       GCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTG
NM_006116.2       GCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTG
                  ************************************************************

HsCD00533703      ACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAG
NM_153497.2       ACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAG
NM_006116.2       ACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAG
                  ************************************************************

HsCD00533703      CTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGGAGAGCACC
NM_153497.2       CTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGGAGAGCACC
NM_006116.2       CTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGGAGAGCACC
                  ************************************************************

HsCD00533703      CGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTCTCAGCGCT
NM_153497.2       CGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTCTCAGCGCT
NM_006116.2       CGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTCTCAGCGCT
                  ************************************************************

HsCD00533703      GCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
NM_153497.2       GCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
NM_006116.2       GCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGCTGGATGGG
                  ************************************************************

HsCD00533703      GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCAT
NM_153497.2       GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCAT
NM_006116.2       GTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCCCAT
                  ************************************************************

HsCD00533703      GGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAG
NM_153497.2       GGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAG
NM_006116.2       GGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAG
                  ************************************************************

HsCD00533703      ACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCTAA---------
NM_153497.2       ACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGAC
NM_006116.2       ACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGAC
                  ************************************************::.         

HsCD00533703      ------------------------------------------------------------
NM_153497.2       ACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACATGACCCTG
NM_006116.2       ACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACATGACCCTG
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       CTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGAGCCCAGCC
NM_006116.2       CTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGAGCCCAGCC
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       CCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCCAGAGCACC
NM_006116.2       CCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCCAGAGCACC
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       AGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGGTCAACGGG
NM_006116.2       AGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGGTCAACGGG
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       GCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAAAGACCCTTCCAGG
NM_006116.2       GCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAAGCCCGACC
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       CCTGCAAGCGATTTGACAGCCATCCCTCAGTG----------------------------
NM_006116.2       TTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTGACGGAGGC
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       ------------------------------------------------------------
NM_006116.2       CTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTGTTGAGCCC
                                                                              

HsCD00533703      ------------------------------------------------------------
NM_153497.2       --------------CCAACTAAACCTCCTGGGCAGCCTGACCCCAGGGTAG---------
NM_006116.2       TATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGCAGAGCGTG
                                                                              

HsCD00533703      ---------------
NM_153497.2       ---------------
NM_006116.2       GTGACAGCACCGTAG
                                 

Pathways

NCI : BMP receptor signaling
NCI : C-MYB transcription factor network
NCI : IL1-mediated signaling events
NCI : Noncanonical Wnt signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of p38-alpha and p38-beta
NCI : TGF-beta receptor signaling
NCI : TNF receptor signaling pathway
NCI : p38 MAPK signaling pathway
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : IL-1 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : PP2Cc : Serine/threonine phosphatases, family 2C, catalytic domain
Structural Annotation Wiki : NYSGXRC-8701a
HPRD : 04012

Clone

Cloning Information : 494259
HIP Master Clone ID : 407939
Original Clone ID : 8701a6BSt3p1

Experimental

TargetTrack - Experimental data : NYSGXRC-8701a

Organism


TAX_ID : 9606
Species Specific ID: 10454

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100324

Reagents

Labome : TAB1-antibody