DNASU Plasmid Repository • 480.965.5697 | Email

MLLT4 (Homo sapiens) in pSGX3 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MLLT4
Gene Name:  myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Sequence             
Original Clone ID: 13165a14BCt7p1
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pSGX3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00534130

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1548nts         Open reading frame : 1 to 1548
Reference Sequence Alignment

ACCCAAGATGCGAGCGGTCCGGAATTGATCCTGCCGGCATCCATCGAATTTCGTGAGAGC
AGCGAGGACAGCTTCCTGTCCGCAATCATCAACTACACCAACAGCAGCACCGTTCACTTT
AAGCTGTCCCCAACCTATGTGCTGTACATGGCATGCCGTTATGTTTTGTCTAACCAGTAC
CGTCCGGACATTAGCCCGACCGAACGCACCCACAAGGTTATCGCGGTCGTGAACAAAATG
GTCAGCATGATGGAGGGCGTCATTCAGAAACAAAAGAACATCGCAGGCGCGCTGGCGTTT
TGGATGGCAAATGCATCTGAACTGCTGAACTTCATTAAGCAGGACCGCGATCTGTCCCGT
ATTACGCTGGACGCGCAAGATGTTCTGGCCCATCTGGTGCAGATGGCTTTCAAGTATCTG
GTCCACTGCCTGCAATCCGAGCTGAACAATTACATGCCTGCATTTCTGGATGATCCGGAA
GAAAACTCCCTGCAACGTCCGAAAATCGACGATGTTCTGCACACTCTGACCGGCGCTATG
TCCCTGCTGCGTCGTTGTCGCGTTAATGCCGCGCTGACCATCCAACTGTTCAGCCAGCTG
TTTCATTTCATCAATATGTGGCTGTTTAACCGTCTGGTGACGGACCCAGACAGCGGTTTG
TGCAGCCACTACTGGGGTGCGATTATCCGCCAGCAGCTGGGTCATATTGAAGCGTGGGCG
GAGAAACAGGGCCTGGAGCTGGCGGCAGATTGCCATTTGAGCCGTATTGTGCAAGCGACC
ACGCTGTTGACTATGGATAAGTACGCGCCAGATGATATCCCGAACATCAATAGCACTTGT
TTCAAACTGAATAGCCTGCAGTTGCAAGCTCTGCTGCAGAATTACCATTGTGCGCCGGAC
GAACCGTTCATCCCGACCGACCTGATTGAAAATGTCGTCACCGTGGCTGAAAACACCGCG
GACGAGTTGGCGCGCTCGGATGGCCGCGAGGTCCAACTGGAGGAGGACCCGGACTTGCAG
CTGCCGTTCCTGCTGCCGGAGGATGGCTACTCGTGCGACGTCGTGCGCAACATTCCGAAT
GGCCTGCAAGAGTTTCTGGACCCGCTGTGCCAACGTGGCTTCTGCCGTCTGATTCCGCAT
ACTCGTAGCCCTGGTACGTGGACGATCTATTTCGAGGGTGCCGATTACGAGAGCCACTTG
CTGCGTGAGAATACCGAACTGGCTCAACCGTTGCGTAAAGAGCCGGAAATCATCACCGTT
ACGCTGAAGAAGCAGAATGGTATGGGTCTGTCTATTGTGGCCGCGAAAGGTGCGGGTCAA
GATAAGTTGGGCATCTACGTCAAGAGCGTCGTTAAGGGTGGTGCGGCTGACGTGGATGGT
CGCCTGGCTGCGGGTGATCAGCTGTTGAGCGTTGATGGTCGTAGCCTGGTCGGCTTGTCC
CAAGAACGTGCGGCTGAGCTGATGACGCGTACCTCGTCTGTGGTGACTCTGGAAGTTGCG
AAACAAGGCGCGATCTACCATGAAGGGCATCATCACCATCACCACTGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-13165a
Recommended expression in: BL21(DE3)-Codon+RIL
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSGX3

pSGX3 in advanced viewed

Synonyms: pSGX-3, pSGX3_BC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: Modified from pET26b from Novagen
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: New York SGX Research Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start initiation start (Met, Ser, Leu) 5072 5079
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4983 5003
repressor protein gene LacI LacI CDS 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5086 5103
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5231 5307

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MLLT4
Symbol Nomenclature : MLLT4
SYNONYM : AF6; RP3-431P23.3
Designation : ALL1-fused gene from chromosome 6 protein|afadin|protein AF-6
Full Nomenclature : myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
GENEID : 4301
Locus Tag : RP3-470B24.4
GenBank Accession : NM_001040001
HGNC : 7137
MIM : 159559
Vega : OTTHUMG00000016031
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ATGTCGGCGGGCGGCCGTGACGAGGAGCGGCGGAAGCTGGCCGACATCATCCACCACTGG
XM_005266997.1      ATGTCGGCGGGCGGCCGTGACGAGGAGCGGCGGAAGCTGGCCGACATCATCCACCACTGG
NM_001040000.2      ATGTCGGCGGGCGGCCGTGACGAGGAGCGGCGGAAGCTGGCCGACATCATCCACCACTGG
XM_005266996.1      ATGTCGGCGGGCGGCCGTGACGAGGAGCGGCGGAAGCTGGCCGACATCATCCACCACTGG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AACGCCAACCGGCTGGACCTGTTCGAGATCAGCCAGCCGACCGAGGATTTGGAGTTCCAT
XM_005266997.1      AACGCCAACCGGCTGGACCTGTTCGAGATCAGCCAGCCGACCGAGGATTTGGAGTTCCAT
NM_001040000.2      AACGCCAACCGGCTGGACCTGTTCGAGATCAGCCAGCCGACCGAGGATTTGGAGTTCCAT
XM_005266996.1      AACGCCAACCGGCTGGACCTGTTCGAGATCAGCCAGCCGACCGAGGATTTGGAGTTCCAT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GGAGTGATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATT
XM_005266997.1      GGAGTGATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATT
NM_001040000.2      GGAGTGATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATT
XM_005266996.1      GGAGTGATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTATT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CGGGTCTCTAGTACTGCCACCACTCAAGATGTAATCGAAACGCTCGCGGAGAAATTTCGA
XM_005266997.1      CGGGTCTCTAGTACTGCCACCACTCAAGATGTAATCGAAACGCTCGCGGAGAAATTTCGA
NM_001040000.2      CGGGTCTCTAGTACTGCCACCACTCAAGATGTAATCGAAACGCTCGCGGAGAAATTTCGA
XM_005266996.1      CGGGTCTCTAGTACTGCCACCACTCAAGATGTAATCGAAACGCTCGCGGAGAAATTTCGA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CCTGATATGCGAATGCTGTCCTCTCCCAAGTATTCACTCTATGAAGTGCATGTCA---GC
XM_005266997.1      CCTGATATGCGAATGCTGTCCTCTCCCAAGTATTCACTCTATGAAGTGCATGTCA---GC
NM_001040000.2      CCTGATATGCGAATGCTGTCCTCTCCCAAGTATTCACTCTATGAAGTGCATGTCAGCG--
XM_005266996.1      CCTGATATGCGAATGCTGTCCTCTCCCAAGTATTCACTCTATGAAGTGCATGTCA---GC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      G---GAGAAAGAAGATTGGATATAGATGAGAAACCTCTAGTTGTACAACTGAATTGGAAC
XM_005266997.1      GGAGAAGAAAGAAGATTGGATATAGATGAGAAACCTCTAGTTGTACAACTGAATTGGAAC
NM_001040000.2      ----GAGAAAGAAGATTGGATATAGATGAGAAACCTCTAGTTGTACAACTGAATTGGAAC
XM_005266996.1      G---GAGAAAGAAGATTGGATATAGATGAGAAACCTCTAGTTGTACAACTGAATTGGAAC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AAAGATGATCGGGAAGGCAGATTTGTTCTTAAGAATGAGAATGACGCCATTCCTCCTAAG
XM_005266997.1      AAAGATGATCGGGAAGGCAGATTTGTTCTTAAGAATGAGAATGACGCCATTCCTCCTAAG
NM_001040000.2      AAAGATGATCGGGAAGGCAGATTTGTTCTTAAGAATGAGAATGACGCCATTCCTCCTAAG
XM_005266996.1      AAAGATGATCGGGAAGGCAGATTTGTTCTTAAGAATGAGAATGACGCCATTCCTCCTAAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GCT---CAAAGTAATGGACCTGAAAAGCAGGAAAAAGAAGGGGTTATCCAGAACTTCAAG
XM_005266997.1      AAGGCTCAAAGTAATGGACCTGAAAAGCAGGAAAAAGAAGGGGTTATCCAGAACTTCAAG
NM_001040000.2      AAGGCTCAAAGTAATGGACCTGAAAAGCAGGAAAAAGAAGGGGTTATCCAGAACTTCAAG
XM_005266996.1      AAGGCTCAAAGTAATGGACCTGAAAAGCAGGAAAAAGAAGGGGTTATCCAGAACTTCAAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAGAGAAAAAGAGGCATTGCGA
XM_005266997.1      AGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAGAGAAAAAGAGGCATTGCGA
NM_001040000.2      AGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAGAGAAAAAGAGGCATTGCGA
XM_005266996.1      AGAACTCTCTCAAAGAAAGAAAAGAAGGAAAAAAAGAAGAGAGAAAAAGAGGCATTGCGA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CAGGCATCTGATAAAGATGATAGACCTTTCCAAGGGGAGGATGTTGAAAATTCTCGACTG
XM_005266997.1      CAGGCATCTGATAAAGATGATAGACCTTTCCAAGGGGAGGATGTTGAAAATTCTCGACTG
NM_001040000.2      CAGGCATCTGATAAAGATGATAGACCTTTCCAAGGGGAGGATGTTGAAAATTCTCGACTG
XM_005266996.1      CAGGCATCTGATAAAGATGATAGACCTTTCCAAGGGGAGGATGTTGAAAATTCTCGACTG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GCTGCTGAGGTTTACAAAGACATGCCGGAAACCAGCTTTACTCGAACCATTTCTAATCCT
XM_005266997.1      GCTGCTGAGGTTTACAAAGACATGCCGGAAACCAGCTTTACTCGAACCATTTCTAATCCT
NM_001040000.2      GCTGCTGAGGTTTACAAAGACATGCCGGAAACCAGCTTTACTCGAACCATTTCTAATCCT
XM_005266996.1      GCTGCTGAGGTTTACAAAGACATGCCGGAAACCAGCTTTACTCGAACCATTTCTAATCCT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GAGGTGGTTATGAAACGACGGAGGCAGCAAAAATTGGAAAAGAGAATGCAGGAATTTCGG
XM_005266997.1      GAGGTGGTTATGAAACGACGGAGGCAGCAAAAATTGGAAAAGAGAATGCAGGAATTTCGG
NM_001040000.2      GAGGTGGTTATGAAACGACGGAGGCAGCAAAAATTGGAAAAGAGAATGCAGGAATTTCGG
XM_005266996.1      GAGGTGGTTATGAAACGACGGAGGCAGCAAAAATTGGAAAAGAGAATGCAGGAATTTCGG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AGCTCAGATGGGCGGCCTGATTCAGGTGGAACATTGAGAATTTATGCAGATAGTTTAAAA
XM_005266997.1      AGCTCAGATGGGCGGCCTGATTCAGGTGGAACATTGAGAATTTATGCAGATAGTTTAAAA
NM_001040000.2      AGCTCAGATGGGCGGCCTGATTCAGGTGGAACATTGAGAATTTATGCAGATAGTTTAAAA
XM_005266996.1      AGCTCAGATGGGCGGCCTGATTCAGGTGGAACATTGAGAATTTATGCAGATAGTTTAAAA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CCAAATATTCCCTACAAGACAATCCTGCTGTCTACTACAGATCCTGCAGACTTTGCTGTG
XM_005266997.1      CCAAATATTCCCTACAAGACAATCCTGCTGTCTACTACAGATCCTGCAGACTTTGCTGTG
NM_001040000.2      CCAAATATTCCCTACAAGACAATCCTGCTGTCTACTACAGATCCTGCAGACTTTGCTGTG
XM_005266996.1      CCAAATATTCCCTACAAGACAATCCTGCTGTCTACTACAGATCCTGCAGACTTTGCTGTG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GCTGAAGCTTTAGAGAAGTATGGTCTGGAAAAAGAAAACCCTAAGGATTACTGCATCGCC
XM_005266997.1      GCTGAAGCTTTAGAGAAGTATGGTCTGGAAAAAGAAAACCCTAAGGATTACTGCATCGCC
NM_001040000.2      GCTGAAGCTTTAGAGAAGTATGGTCTGGAAAAAGAAAACCCTAAGGATTACTGCATCGCC
XM_005266996.1      GCTGAAGCTTTAGAGAAGTATGGTCTGGAAAAAGAAAACCCTAAGGATTACTGCATCGCC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAAAAGGGTGCTAAAGAAATTATT
XM_005266997.1      CGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAAAAGGGTGCTAAAGAAATTATT
NM_001040000.2      CGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAAAAGGGTGCTAAAGAAATTATT
XM_005266996.1      CGGGTTATGCTTCCTCCTGGAGCCCAGCATTCTGATGAAAAGGGTGCTAAAGAAATTATT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CTTGATGATGATGAGTGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATT
XM_005266997.1      CTTGATGATGATGAGTGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATT
NM_001040000.2      CTTGATGATGATGAGTGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATT
XM_005266996.1      CTTGATGATGATGAGTGTCCTTTACAAATCTTCAGGGAATGGCCAAGTGACAAAGGGATT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TTAGTCTTTCAGTTGAAGAGGAGGCCACCAGACCACATCCCAAAGAAAACCAAGAAACAC
XM_005266997.1      TTAGTCTTTCAGTTGAAGAGGAGGCCACCAGACCACATCCCAAAGAAAACCAAGAAACAC
NM_001040000.2      TTAGTCTTTCAGTTGAAGAGGAGGCCACCAGACCACATCCCAAAGAAAACCAAGAAACAC
XM_005266996.1      TTAGTCTTTCAGTTGAAGAGGAGGCCACCAGACCACATCCCAAAGAAAACCAAGAAACAC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TTGGAAGGCAAGACACCCAAGGGAAAGGAGAGAGCTGACGGGTCTGGCTATGGCTCCACC
XM_005266997.1      TTGGAAGGCAAGACACCCAAGGGAAAGGAGAGAGCTGACGGGTCTGGCTATGGCTCCACC
NM_001040000.2      TTGGAAGGCAAGACACCCAAGGGAAAGGAGAGAGCTGACGGGTCTGGCTATGGCTCCACC
XM_005266996.1      TTGGAAGGCAAGACACCCAAGGGAAAGGAGAGAGCTGACGGGTCTGGCTATGGCTCCACC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CTTCCTCCGGAGAAGCTGCCCTATTTAGTAGAGTTAAGCCCAG-----------------
XM_005266997.1      CTTCCTCCGGAGAAGCTGCCCTATTTAGTAGAGTTAAGCCCAGGGAGAAGGAATCACTTT
NM_001040000.2      CTTCCTCCGGAGAAGCTGCCCTATTTAGTAGAGTTAAGCCCAGGGAGAAGGAATCACTTT
XM_005266996.1      CTTCCTCCGGAGAAGCTGCCCTATTTAGTAGAGTTAAGCCCAGGGAGAAGGAATCACTTT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ----------------------------ATGGTTCTGACTCTAGAGATAAGCCAAAGCTT
XM_005266997.1      GCCTACTACAACTATCACACTTACGAAGATGGTTCTGACTCTAGAGATAAGCCAAAGCTT
NM_001040000.2      GCCTACTACAACTATCACACTTACGAAGATGGTTCTGACTCTAGAGATAAGCCAAAGCTT
XM_005266996.1      GCCTACTACAACTATCACACTTACGAAGATGGTTCTGACTCTAGAGATAAGCCAAAGCTT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TACCGCCTTCAGTTAAGTGTTACTGAAGTTGGGACAGAAAAGTTGGATGACAACTCTATC
XM_005266997.1      TACCGCCTTCAGTTAAGTGTTACTGAAGTTGGGACAGAAAAGTTGGATGACAACTCTATC
NM_001040000.2      TACCGCCTTCAGTTAAGTGTTACTGAAGTTGGGACAGAAAAGTTGGATGACAACTCTATC
XM_005266996.1      TACCGCCTTCAGTTAAGTGTTACTGAAGTTGGGACAGAAAAGTTGGATGACAACTCTATC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CAGTTGTTTGGCCCAGGAATTCAGCCCCATCACTGTGACCTTACCAACATGGATGGAGTG
XM_005266997.1      CAGTTGTTTGGCCCAGGAATTCAGCCCCATCACTGTGACCTTACCAACATGGATGGAGTG
NM_001040000.2      CAGTTGTTTGGCCCAGGAATTCAGCCCCATCACTGTGACCTTACCAACATGGATGGAGTG
XM_005266996.1      CAGTTGTTTGGCCCAGGAATTCAGCCCCATCACTGTGACCTTACCAACATGGATGGAGTG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GTCACTGTGACGCCCAGAAGTATGGACGCAGAAACCTACGTGGAAGGCCAGCGCATCTCA
XM_005266997.1      GTCACTGTGACGCCCAGAAGTATGGACGCAGAAACCTACGTGGAAGGCCAGCGCATCTCA
NM_001040000.2      GTCACTGTGACGCCCAGAAGTATGGACGCAGAAACCTACGTGGAAGGCCAGCGCATCTCA
XM_005266996.1      GTCACTGTGACGCCCAGAAGTATGGACGCAGAAACCTACGTGGAAGGCCAGCGCATCTCA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GAAACCACCATGCTGCAGAGTGGCATGAAAGTGCAGTTTGGGGCGTCCCATGTATTTAAG
XM_005266997.1      GAAACCACCATGCTGCAGAGTGGCATGAAAGTGCAGTTTGGGGCGTCCCATGTATTTAAG
NM_001040000.2      GAAACCACCATGCTGCAGAGTGGCATGAAAGTGCAGTTTGGGGCGTCCCATGTATTTAAG
XM_005266996.1      GAAACCACCATGCTGCAGAGTGGCATGAAAGTGCAGTTTGGGGCGTCCCATGTATTTAAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TTTGTGGACCCCAGTCAGGATCATGCTCTTGCAAAAAGATCTGTGGATGGAGGCCTGATG
XM_005266997.1      TTTGTGGACCCCAGTCAGGATCATGCTCTTGCAAAAAGATCTGTGGATGGAGGCCTGATG
NM_001040000.2      TTTGTGGACCCCAGTCAGGATCATGCTCTTGCAAAAAGATCTGTGGATGGAGGCCTGATG
XM_005266996.1      TTTGTGGACCCCAGTCAGGATCATGCTCTTGCAAAAAGATCTGTGGATGGAGGCCTGATG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GTTAAGGGCCCAAGACATAAACCTGGAATTGTTCAGGAGACAACTTTTGATTTGGGAGGA
XM_005266997.1      GTTAAGGGCCCAAGACATAAACCTGGAATTGTTCAGGAGACAACTTTTGATTTGGGAGGA
NM_001040000.2      GTTAAGGGCCCAAGACATAAACCTGGAATTGTTCAGGAGACAACTTTTGATTTGGGAGGA
XM_005266996.1      GTTAAGGGCCCAAGACATAAACCTGGAATTGTTCAGGAGACAACTTTTGATTTGGGAGGA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GATATTCATAGTGGGACAGCATTACCGACAAGCAAGAGCACCACTAGGCTGGACAGCGAC
XM_005266997.1      GATATTCATAGTGGGACAGCATTACCGACAAGCAAGAGCACCACTAGGCTGGACAGCGAC
NM_001040000.2      GATATTCATAGTGGGACAGCATTACCGACAAGCAAGAGCACCACTAGGCTGGACAGCGAC
XM_005266996.1      GATATTCATAGTGGGACAGCATTACCGACAAGCAAGAGCACCACTAGGCTGGACAGCGAC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AGAGTGTCGTCTGCCTCTAGCACAGCCGAGCGGGGAATGGTGAAGCCGATGATCAGAGTA
XM_005266997.1      AGAGTGTCGTCTGCCTCTAGCACAGCCGAGCGGGGAATGGTGAAGCCGATGATCAGAGTA
NM_001040000.2      AGAGTGTCGTCTGCCTCTAGCACAGCCGAGCGGGGAATGGTGAAGCCGATGATCAGAGTA
XM_005266996.1      AGAGTGTCGTCTGCCTCTAGCACAGCCGAGCGGGGAATGGTGAAGCCGATGATCAGAGTA
                                                                                

HsCD00534130        ------------------------------------ACCCAAGATGCGAGCGGTCCGGAA
NM_001207008.1      GAACAGCAGCCAGATTATCGCAGGCAAGAAAGCAGAACACAGGATGCTTCTGGGCCTGAG
XM_005266997.1      GAACAGCAGCCAGATTATCGCAGGCAAGAAAGCAGAACACAGGATGCTTCTGGGCCTGAG
NM_001040000.2      GAACAGCAGCCAGATTATCGCAGGCAAGAAAGCAGAACACAGGATGCTTCTGGGCCTGAG
XM_005266996.1      GAACAGCAGCCAGATTATCGCAGGCAAGAAAGCAGAACACAGGATGCTTCTGGGCCTGAG
                                                        **.**.***** :  ** ** **.

HsCD00534130        TTGATCCTGCCGGCATCCATCGAATTTCGTGAGAGCAGCGAGGACAGCTTCCTGTCCGCA
NM_001207008.1      CTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCC
XM_005266997.1      CTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCC
NM_001040000.2      CTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCC
XM_005266996.1      CTGATACTACCTGCAAGCATTGAATTCAGGGAAAGTTCTGAAGATTCATTTTTGTCTGCC
                     ****.**.** ***: *** ***** .* **.** :  **.** : .**  **** **.

HsCD00534130        ATCATCAACTACACCAACAGCAGCACCGTTCACTTTAAGCTGTCCCCAACCTATGTGCTG
NM_001207008.1      ATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTA
XM_005266997.1      ATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTA
NM_001040000.2      ATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTA
XM_005266996.1      ATTATAAATTATACTAATAGCTCTACAGTCCACTTTAAGTTGTCCCCTACATATGTATTA
                    ** **.** ** ** ** ***:  **.** ********* *******:**.*****. *.

HsCD00534130        TACATGGCATGCCGTTATGTTTTGTCTAACCAGTACCGTCCGGACATTAGCCCGACCGAA
NM_001207008.1      TATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAG
XM_005266997.1      TATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAG
NM_001040000.2      TATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAG
XM_005266996.1      TATATGGCATGCCGGTATGTATTGTCCAACCAGTACAGACCTGACATCAGCCCTACAGAG
                    ** *********** *****:***** *********.*:** ***** ***** **.**.

HsCD00534130        CGCACCCACAAGGTTATCGCGGTCGTGAACAAAATGGTCAGCATGATGGAGGGCGTCATT
NM_001207008.1      CGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATC
XM_005266997.1      CGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATC
NM_001040000.2      CGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATC
XM_005266996.1      CGCACACATAAAGTCATTGCAGTCGTCAACAAGATGGTGAGCATGATGGAGGGTGTCATC
                    *****.** **.** ** **.***** *****.***** ************** ***** 

HsCD00534130        CAGAAACAAAAGAACATCGCAGGCGCGCTGGCGTTTTGGATGGCAAATGCATCTGAACTG
NM_001207008.1      CAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTT
XM_005266997.1      CAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTT
NM_001040000.2      CAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTT
XM_005266996.1      CAGAAACAGAAGAATATTGCAGGGGCACTTGCCTTCTGGATGGCAAATGCATCTGAACTT
                    ********.***** ** ***** **.** ** ** *********************** 

HsCD00534130        CTGAACTTCATTAAGCAGGACCGCGATCTGTCCCGTATTACGCTGGACGCGCAAGATGTT
NM_001207008.1      CTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTT
XM_005266997.1      CTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTT
NM_001040000.2      CTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTT
XM_005266996.1      CTCAACTTCATTAAGCAAGACCGAGACCTTAGTCGGATCACACTGGATGCTCAAGATGTT
                    ** **************.*****.** ** :  ** ** **.***** ** *********

HsCD00534130        CTGGCCCATCTGGTGCAGATGGCTTTCAAGTATCTGGTCCACTGCCTGCAATCCGAGCTG
NM_001207008.1      TTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTT
XM_005266997.1      TTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTT
NM_001040000.2      TTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTT
XM_005266996.1      TTAGCACATTTGGTTCAAATGGCATTTAAATACTTGGTTCACTGTCTTCAATCAGAACTT
                     *.**.*** **** **.*****:** **.**  **** ***** ** *****.**.** 

HsCD00534130        AACAATTACATGCCTGCATTTCTGGATGATCCGGAAGAAAACTCCCTGCAACGTCCGAAA
NM_001207008.1      AATAATTACATGCCAGCCTTTCTAGATGACCCTGAAGAGAACAGTCTGCAACGACCAAAA
XM_005266997.1      AATAATTACATGCCAGCCTTTCTAGATGACCCTGAAGAGAACAGTCTGCAACGACCAAAA
NM_001040000.2      AATAATTACATGCCAGCCTTTCTAGATGACCCTGAAGAGAACAGTCTGCAACGACCAAAA
XM_005266996.1      AATAATTACATGCCAGCCTTTCTAGATGACCCTGAAGAGAACAGTCTGCAACGACCAAAA
                    ** ***********:**.*****.***** ** *****.***:  ********:**.***

HsCD00534130        ATCGACGATGTTCTGCACACTCTGACCGGCGCTATGTCCCTGCTGCGTCGTTGTCGCGTT
NM_001207008.1      ATAGATGATGTGCTGCACACGCTCACAGGAGCCATGTCCTTGCTACGACGCTGCAGAGTC
XM_005266997.1      ATAGATGATGTGCTGCACACGCTCACAGGAGCCATGTCCTTGCTACGACGCTGCAGAGTC
NM_001040000.2      ATAGATGATGTGCTGCACACGCTCACAGGAGCCATGTCCTTGCTACGACGCTGCAGAGTC
XM_005266996.1      ATAGATGATGTGCTGCACACGCTCACAGGAGCCATGTCCTTGCTACGACGCTGCAGAGTC
                    **.** ***** ******** ** **.**.** ****** ****.**:** ** .*.** 

HsCD00534130        AATGCCGCGCTGACCATCCAACTGTTCAGCCAGCTGTTTCATTTCATCAATATGTGGCTG
NM_001207008.1      AATGCCGCCCTGACCATCCAGCTCTTCTCTCAGCTCTTCCACTTCATCAATATGTGGCTG
XM_005266997.1      AATGCCGCCCTGACCATCCAGCTCTTCTCTCAGCTCTTCCACTTCATCAATATGTGGCTG
NM_001040000.2      AATGCCGCCCTGACCATCCAGCTCTTCTCTCAGCTCTTCCACTTCATCAATATGTGGCTG
XM_005266996.1      AATGCCGCCCTGACCATCCAGCTCTTCTCTCAGCTCTTCCACTTCATCAATATGTGGCTG
                    ******** ***********.** ***:  ***** ** ** ******************

HsCD00534130        TTTAACCGTCTGGTGACGGACCCAGACAGCGGTTTGTGCAGCCACTACTGGGGTGCGATT
NM_001207008.1      TTCAATAGATTGGTGACCGACCCAGATTCGGGGCTGTGCTCCCATTACTGGGGTGCGATT
XM_005266997.1      TTCAATAGATTGGTGACCGACCCAGATTCGGGGCTGTGCTCCCATTACTGGGGTGCGATT
NM_001040000.2      TTCAATAGATTGGTGACCGACCCAGATTCGGGGCTGTGCTCCCATTACTGGGGTGCGATT
XM_005266996.1      TTCAATAGATTGGTGACCGACCCAGATTCGGGGCTGTGCTCCCATTACTGGGGTGCGATT
                    ** ** .*: ******* ******** :  **  *****: *** ***************

HsCD00534130        ATCCGCCAGCAGCTGGGTCATATTGAAGCGTGGGCGGAGAAACAGGGCCTGGAGCTGGCG
NM_001207008.1      ATCCGTCAGCAGTTGGGCCATATTGAAGCCTGGGCTGAGAAGCAGGGGCTGGAACTGGCT
XM_005266997.1      ATCCGTCAGCAGTTGGGCCATATTGAAGCCTGGGCTGAGAAGCAGGGGCTGGAACTGGCT
NM_001040000.2      ATCCGTCAGCAGTTGGGCCATATTGAAGCCTGGGCTGAGAAGCAGGGGCTGGAACTGGCT
XM_005266996.1      ATCCGTCAGCAGTTGGGCCATATTGAAGCCTGGGCTGAGAAGCAGGGGCTGGAACTGGCT
                    ***** ****** **** *********** ***** *****.***** *****.***** 

HsCD00534130        GCAGATTGCCATTTGAGCCGTATTGTGCAAGCGACCACGCTGTTGACTATGGATAAGTAC
NM_001207008.1      GCGGACTGTCATCTGAGCAGGATCGTGCAGGCAACGACTTTGCTTACCATGGATAAGTAT
XM_005266997.1      GCGGACTGTCATCTGAGCAGGATCGTGCAGGCAACGACTTTGCTTACCATGGATAAGTAT
NM_001040000.2      GCGGACTGTCATCTGAGCAGGATCGTGCAGGCAACGACTTTGCTTACCATGGATAAGTAT
XM_005266996.1      GCGGACTGTCATCTGAGCAGGATCGTGCAGGCAACGACTTTGCTTACCATGGATAAGTAT
                    **.** ** *** *****.* ** *****.**.** **  ** * ** *********** 

HsCD00534130        GCGCCAGATGATATCCCGAACATCAATAGCACTTGTTTCAAACTGAATAGCCTGCAGTTG
NM_001207008.1      GCACCTGATGACATTCCAAATATAAACAGCACCTGCTTTAAGTTAAATTCATTACAACTT
XM_005266997.1      GCACCTGATGACATTCCAAATATAAACAGCACCTGCTTTAAGTTAAATTCATTACAACTT
NM_001040000.2      GCACCTGATGACATTCCAAATATAAACAGCACCTGCTTTAAGTTAAATTCATTACAACTT
XM_005266996.1      GCACCTGATGACATTCCAAATATAAACAGCACCTGCTTTAAGTTAAATTCATTACAACTT
                    **.**:***** ** **.** **.** ***** ** ** **. *.***: . *.**. * 

HsCD00534130        CAAGCTCTGCTGCAGAATTACCATTGTGCGCCGGACGAACCGTTCATCCCGACCGACCTG
NM_001207008.1      CAAGCCTTATTACAGAACTATCACTGTGCACCTGATGAGCCTTTTATCCCAACGGATCTT
XM_005266997.1      CAAGCCTTATTACAGAACTATCACTGTGCACCTGATGAGCCTTTTATCCCAACGGATCTT
NM_001040000.2      CAAGCCTTATTACAGAACTATCACTGTGCACCTGATGAGCCTTTTATCCCAACGGATCTT
XM_005266996.1      CAAGCCTTATTACAGAACTATCACTGTGCACCTGATGAGCCTTTTATCCCAACGGATCTT
                    *****  *. *.***** ** ** *****.** ** **.** ** *****.** ** ** 

HsCD00534130        ATTGAAAATGTCGTCACCGTGGCTGAAAACACCGCGGACGAGTTGGCGCGCTCGGATGGC
NM_001207008.1      ATAGAAAATGTAGTGACTGTGGCTGAAAACACTGCCGATGAGCTGGCCCGCAGTGATGGA
XM_005266997.1      ATAGAAAATGTAGTGACTGTGGCTGAAAACACTGCCGATGAGCTGGCCCGCAGTGATGGA
NM_001040000.2      ATAGAAAATGTAGTGACTGTGGCTGAAAACACTGCCGATGAGCTGGCCCGCAGTGATGGA
XM_005266996.1      ATAGAAAATGTAGTGACTGTGGCTGAAAACACTGCCGATGAGCTGGCCCGCAGTGATGGA
                    **:********.** ** ************** ** ** *** **** ***:  *****.

HsCD00534130        CGCGAGGTCCAACTGGAGGAGGACCCGGACTTGCAGCTGCCGTTCCTGCTGCCGGAGGAT
NM_001207008.1      AGGGAAGTGCAGTTGGAGGAGGATCCTGATCTGCAGCTGCCGTTTCTTTTGCCAGAAGAT
XM_005266997.1      AGGGAAGTGCAGTTGGAGGAGGATCCTGATCTGCAGCTGCCGTTTCTTTTGCCAGAAGAT
NM_001040000.2      AGGGAAGTGCAGTTGGAGGAGGATCCTGATCTGCAGCTGCCGTTTCTTTTGCCAGAAGAT
XM_005266996.1      AGGGAAGTGCAGTTGGAGGAGGATCCTGATCTGCAGCTGCCGTTTCTTTTGCCAGAAGAT
                    .* **.** **. ********** ** **  ************* **  ****.**.***

HsCD00534130        GGCTACTCGTGCGACGTCGTGCGCAACATTCCGAATGGCCTGCAAGAGTTTCTGGACCCG
NM_001207008.1      GGTTATTCTTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCT
XM_005266997.1      GGTTATTCTTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCT
NM_001040000.2      GGTTATTCTTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCT
XM_005266996.1      GGTTATTCTTGTGATGTTGTCAGAAACATTCCAAATGGTTTACAAGAATTTTTAGACCCT
                    ** ** ** ** ** ** ** .*.********.*****  *.*****.*** *.***** 

HsCD00534130        CTGTGCCAACGTGGCTTCTGCCGTCTGATTCCGCATACTCGTAGCCCTGGTACGTGGACG
NM_001207008.1      CTGTGCCAGAGAGGATTTTGCAGGTTAATTCCTCACACACGTTCACCAGGTACTTGGACA
XM_005266997.1      CTGTGCCAGAGAGGATTTTGCAGGTTAATTCCTCACACACGTTCACCAGGTACTTGGACA
NM_001040000.2      CTGTGCCAGAGAGGATTTTGCAGGTTAATTCCTCACACACGTTCACCAGGTACTTGGACA
XM_005266996.1      CTGTGCCAGAGAGGATTTTGCAGGTTAATTCCTCACACACGTTCACCAGGTACTTGGACA
                    ********..*:**.** ***.*  *.***** ** **:***: .**:***** *****.

HsCD00534130        ATCTATTTCGAGGGTGCCGATTACGAGAGCCACTTGCTGCGTGAGAATACCGAACTGGCT
NM_001207008.1      ATATATTTTGAAGGTGCAGATTATGAAAGTCACCTTCTGCGTGAGAACACAGAGCTGGCT
XM_005266997.1      ATATATTTTGAAGGTGCAGATTATGAAAGTCACCTTCTGCGTGAGAACACAGAGCTGGCT
NM_001040000.2      ATATATTTTGAAGGTGCAGATTATGAAAGTCACCTTCTGCGTGAGAACACAGAGCTGGCT
XM_005266996.1      ATATATTTTGAAGGTGCAGATTATGAAAGTCACCTTCTGCGTGAGAACACAGAGCTGGCT
                    **.***** **.*****.***** **.** *** * *********** **.**.******

HsCD00534130        CAACCGTTGCGTAAAGAGCCGGAAATCATCACCGTTACGCTGAAGAAGCAGAATGGTATG
NM_001207008.1      CAGCCTCTGAGGAAAGAACCTGAAATAATCACTGTGACCCTAAAAAAGCAGAATGGAATG
XM_005266997.1      CAGCCTCTGAGGAAAGAACCTGAAATAATCACTGTGACCCTAAAAAAGCAGAATGGAATG
NM_001040000.2      CAGCCTCTGAGGAAAGAACCTGAAATAATCACTGTGACCCTAAAAAAGCAGAATGGAATG
XM_005266996.1      CAGCCTCTGAGGAAAGAACCTGAAATAATCACTGTGACCCTAAAAAAGCAGAATGGAATG
                    **.**  **.* *****.** *****.***** ** ** **.**.***********:***

HsCD00534130        GGTCTGTCTATTGTGGCCGCGAAAGGTGCGGGTCAAGATAAGTTGGGCATCTACGTCAAG
NM_001207008.1      GGCCTTAGCATTGTTGCAGCAAAGGGTGCTGGTCAAGATAAACTAGGAATCTATGTGAAG
XM_005266997.1      GGCCTTAGCATTGTTGCAGCAAAGGGTGCTGGTCAAGATAAACTAGGAATCTATGTGAAG
NM_001040000.2      GGCCTTAGCATTGTTGCAGCAAAGGGTGCTGGTCAAGATAAACTAGGAATCTATGTGAAG
XM_005266996.1      GGCCTTAGCATTGTTGCAGCAAAGGGTGCTGGTCAAGATAAACTAGGAATCTATGTGAAG
                    ** ** :  ***** **.**.**.***** ***********. *.**.***** ** ***

HsCD00534130        AGCGTCGTTAAGGGTGGTGCGGCTGACGTGGATGGTCGCCTGGCTGCGGGTGATCAGCTG
NM_001207008.1      TCGGTTGTGAAAGGAGGTGCTGCAGATG---ATGGACGTCTAGCTGCAGGTGATCAGCTC
XM_005266997.1      TCGGTTGTGAAAGGAGGTGCTGCAGATGTGGATGGACGTCTAGCTGCAGGTGATCAGCTC
NM_001040000.2      TCGGTTGTGAAAGGAGGTGCTGCAGATGTGGATGGACGTCTAGCTGCAGGTGATCAGCTC
XM_005266996.1      TCGGTTGTGAAAGGAGGTGCTGCAGATGTGGATGGACGTCTAGCTGCAGGTGATCAGCTC
                    :  ** ** **.**:***** **:** *   ****:** **.*****.*********** 

HsCD00534130        TTGAGCGTTGATGGTCGTAGCCTGGTCGGCTTGTCCCAAGAACGTGCGGCTGAGCTGATG
NM_001207008.1      CTCAGTGTGGATGGACGAAGTCTGGTTGGACTCTCTCAGGAAAGGGCGGCAGAACTCATG
XM_005266997.1      CTCAGTGTGGATGGACGAAGTCTGGTTGGACTCTCTCAGGAAAGGGCGGCAGAACTCATG
NM_001040000.2      CTCAGTGTGGATGGACGAAGTCTGGTTGGACTCTCTCAGGAAAGGGCGGCAGAACTCATG
XM_005266996.1      CTCAGTGTGGATGGACGAAGTCTGGTTGGACTCTCTCAGGAAAGGGCGGCAGAACTCATG
                     * ** ** *****:**:** ***** **. * ** **.***.* *****:**.** ***

HsCD00534130        ACGCGTACCTCGTCTGTGGTGACTCTGGAAGTTGCGAAACAAGGCGCGATCTACCATGAA
NM_001207008.1      ACAAGAACAAGCTCTGTGGTGACACTGGAAGTAGCAAAGCAGGGTGCCATCTACCACGGT
XM_005266997.1      ACAAGAACAAGCTCTGTGGTGACACTGGAAGTAGCAAAGCAGGGTGCCATCTACCACGGT
NM_001040000.2      ACAAGAACAAGCTCTGTGGTGACACTGGAAGTAGCAAAGCAGGGTGCCATCTACCACGGT
XM_005266996.1      ACAAGAACAAGCTCTGTGGTGACACTGGAAGTAGCAAAGCAGGGTGCCATCTACCACGGT
                    **..*:**.:  ***********:********:**.**.**.** ** ******** *.:

HsCD00534130        GGGCATCATCACCATCACCACTGA------------------------------------
NM_001207008.1      CTGGCCACCCTTCTCAATCAGCCATCCCCCATGATGCAGAGAATTTCAGATCGTCGTGGC
XM_005266997.1      CTGGCCACCCTTCTCAATCAGCCATCCCCCATGATGCAGAGAATTTCAGATCGTCGTGGC
NM_001040000.2      CTGGCCACCCTTCTCAATCAGCCATCCCCCATGATGCAGAGAATTTCAGATCGTCGTGGC
XM_005266996.1      CTGGCCACCCTTCTCAATCAGCCATCCCCCATGATGCAGAGAATTTCAGATCGTCGTGGC
                      * . .. *: *: .* **   *                                    

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TCAGGTAAACCCCGACCAAAGAGTGAAGGCTTTGAGCTCTATAATAATTCAACTCAAAAT
XM_005266997.1      TCAGGTAAACCCCGACCAAAGAGTGAAGGCTTTGAGCTCTATAATAATTCAACTCAAAAT
NM_001040000.2      TCAGGTAAACCCCGACCAAAGAGTGAAGGCTTTGAGCTCTATAATAATTCAACTCAAAAT
XM_005266996.1      TCAGGTAAACCCCGACCAAAGAGTGAAGGCTTTGAGCTCTATAATAATTCAACTCAAAAT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GGGTCTCCTGAGAGTCCTCAGCTGCCTTGGGCAGAATATAGTGAACCAAAGAAATTGCCT
XM_005266997.1      GGGTCTCCTGAGAGTCCTCAGCTGCCTTGGGCAGAATATAGTGAACCAAAGAAATTGCCT
NM_001040000.2      GGGTCTCCTGAGAGTCCTCAGCTGCCTTGGGCAGAATATAGTGAACCAAAGAAATTGCCT
XM_005266996.1      GGGTCTCCTGAGAGTCCTCAGCTGCCTTGGGCAGAATATAGTGAACCAAAGAAATTGCCT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GGTGATGACAGACTGATGAAAAATAGAGCTGATCACCGTTCCAGCCCCAACGTAGCAAAT
XM_005266997.1      GGTGATGACAGACTGATGAAAAATAGAGCTGATCACCGTTCCAGCCCCAACGTAGCAAAT
NM_001040000.2      GGTGATGACAGACTGATGAAAAATAGAGCTGATCACCGTTCCAGCCCCAACGTAGCAAAT
XM_005266996.1      GGTGATGACAGACTGATGAAAAATAGAGCTGATCACCGTTCCAGCCCCAACGTAGCAAAT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CAGCCTCCTAGTCCTGGAGGGAAAAGTGCATATGCCTCTGGAACAACAGCGAAGATAACA
XM_005266997.1      CAGCCTCCTAGTCCTGGAGGGAAAAGTGCATATGCCTCTGGAACAACAGCGAAGATAACA
NM_001040000.2      CAGCCTCCTAGTCCTGGAGGGAAAAGTGCATATGCCTCTGGAACAACAGCGAAGATAACA
XM_005266996.1      CAGCCTCCTAGTCCTGGAGGGAAAAGTGCATATGCCTCTGGAACAACAGCGAAGATAACA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TCTGTCTCTACTGGAAACCTCTGCACTGAGGAGCAGACGCCTCCGCCTAGACCTGAAGCC
XM_005266997.1      TCTGTCTCTACTGGAAACCTCTGCACTGAGGAGCAGACGCCTCCGCCTAGACCTGAAGCC
NM_001040000.2      TCTGTCTCTACTGGAAACCTCTGCACTGAGGAGCAGACGCCTCCGCCTAGACCTGAAGCC
XM_005266996.1      TCTGTCTCTACTGGAAACCTCTGCACTGAGGAGCAGACGCCTCCGCCTAGACCTGAAGCC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TACCCCATCCCCACTCAGACGTACACCAGAGAGTATTTTACCTTCCCAGCTTCCAAATCC
XM_005266997.1      TACCCCATCCCCACTCAGACGTACACCAGAGAGTATTTTACCTTCCCAGCTTCCAAATCC
NM_001040000.2      TACCCCATCCCCACTCAGACGTACACCAGAGAGTATTTTACCTTCCCAGCTTCCAAATCC
XM_005266996.1      TACCCCATCCCCACTCAGACGTACACCAGAGAGTATTTTACCTTCCCAGCTTCCAAATCC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CAGGATCGGATGGCTCCTCCTCAGAACCAGTGGCCAAATTATGAGGAAAAGCCACATATG
XM_005266997.1      CAGGATCGGATGGCTCCTCCTCAGAACCAGTGGCCAAATTATGAGGAAAAGCCACATATG
NM_001040000.2      CAGGATCGGATGGCTCCTCCTCAGAACCAGTGGCCAAATTATGAGGAAAAGCCACATATG
XM_005266996.1      CAGGATCGGATGGCTCCTCCTCAGAACCAGTGGCCAAATTATGAGGAAAAGCCACATATG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CACACAGATAGTAATCATTCCAGTATTGCAATTCAGCGTGTTACACGTTCCCAAGAAGAA
XM_005266997.1      CACACAGATAGTAATCATTCCAGTATTGCAATTCAGCGTGTTACACGTTCCCAAGAAGAA
NM_001040000.2      CACACAGATAGTAATCATTCCAGTATTGCAATTCAGCGTGTTACACGTTCCCAAGAAGAA
XM_005266996.1      CACACAGATAGTAATCATTCCAGTATTGCAATTCAGCGTGTTACACGTTCCCAAGAAGAA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CTTCGAGAAGATAAAGCTTACCAACTTGAGCGGCATCGAATAGAGGCAGCTATGGACCGA
XM_005266997.1      CTTCGAGAAGATAAAGCTTACCAACTTGAGCGGCATCGAATAGAGGCAGCTATGGACCGA
NM_001040000.2      CTTCGAGAAGATAAAGCTTACCAACTTGAGCGGCATCGAATAGAGGCAGCTATGGACCGA
XM_005266996.1      CTTCGAGAAGATAAAGCTTACCAACTTGAGCGGCATCGAATAGAGGCAGCTATGGACCGA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AAGTCTGATAGTGATATGTGGATAAATCAGAGCTCCTCACTGGACTCCAGTACCTCTAGC
XM_005266997.1      AAGTCTGATAGTGATATGTGGATAAATCAGAGCTCCTCACTGGACTCCAGTACCTCTAGC
NM_001040000.2      AAGTCTGATAGTGATATGTGGATAAATCAGAGCTCCTCACTGGACTCCAGTACCTCTAGC
XM_005266996.1      AAGTCTGATAGTGATATGTGGATAAATCAGAGCTCCTCACTGGACTCCAGTACCTCTAGC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CAGGAGCATCTGAACCATTCCTCTAAGTCGGTCACCCCTGCTTCCACACTGACCAAAAGT
XM_005266997.1      CAGGAGCATCTGAACCATTCCTCTAAGTCGGTCACCCCTGCTTCCACACTGACCAAAAGT
NM_001040000.2      CAGGAGCATCTGAACCATTCCTCTAAGTCGGTCACCCCTGCTTCCACACTGACCAAAAGT
XM_005266996.1      CAGGAGCATCTGAACCATTCCTCTAAGTCGGTCACCCCTGCTTCCACACTGACCAAAAGT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GGCCCTGGCCGTTGGAAAACACCAGCAGCCATACCGGCCACCCCTGTGGCCGTCTCCCAG
XM_005266997.1      GGCCCTGGCCGTTGGAAAACACCAGCAGCCATACCGGCCACCCCTGTGGCCGTCTCCCAG
NM_001040000.2      GGCCCTGGCCGTTGGAAAACACCAGCAGCCATACCGGCCACCCCTGTGGCCGTCTCCCAG
XM_005266996.1      GGCCCTGGCCGTTGGAAAACACCAGCAGCCATACCGGCCACCCCTGTGGCCGTCTCCCAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CCAATCCGAACAGACCTGCCTCCGCCACCCCCGCCACCTCCAGTCCACTATGCCGGTGAT
XM_005266997.1      CCAATCCGAACAGACCTGCCTCCGCCACCCCCGCCACCTCCAGTCCACTATGCCGGTGAT
NM_001040000.2      CCAATCCGAACAGACCTGCCTCCGCCACCCCCGCCACCTCCAGTCCACTATGCCGGTGAT
XM_005266996.1      CCAATCCGAACAGACCTGCCTCCGCCACCCCCGCCACCTCCAGTCCACTATGCCGGTGAT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TTCGATGGAATGTCCATGGATTTGCCTCTCCCACCACCCCCTTCCGCCAACCAGATAGGG
XM_005266997.1      TTCGATGGAATGTCCATGGATTTGCCTCTCCCACCACCCCCTTCCGCCAACCAGATAGGG
NM_001040000.2      TTCGATGGAATGTCCATGGATTTGCCTCTCCCACCACCCCCTTCCGCCAACCAGATAGGG
XM_005266996.1      TTCGATGGAATGTCCATGGATTTGCCTCTCCCACCACCCCCTTCCGCCAACCAGATAGGG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CTGCCGTCTGCGCAGGTGGCTGCTGCTGAACGGAGAAAGAGAGAAGAACATCAGCGTTGG
XM_005266997.1      CTGCCGTCTGCGCAGGTGGCTGCTGCTGAACGGAGAAAGAGAGAAGAACATCAGCGTTGG
NM_001040000.2      CTGCCGTCTGCGCAGGTGGCTGCTGCTGAACGGAGAAAGAGAGAAGAACATCAGCGTTGG
XM_005266996.1      CTGCCGTCTGCGCAGGTGGCTGCTGCTGAACGGAGAAAGAGAGAAGAACATCAGCGTTGG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TATGAGAAGGAGAAGGCCCGCCTGGAGGAGGAGCGGGAGAGGAAGCGGAGAGAGCAGGAG
XM_005266997.1      TATGAGAAGGAGAAGGCCCGCCTGGAGGAGGAGCGGGAGAGGAAGCGGAGAGAGCAGGAG
NM_001040000.2      TATGAGAAGGAGAAGGCCCGCCTGGAGGAGGAGCGGGAGAGGAAGCGGAGAGAGCAGGAG
XM_005266996.1      TATGAGAAGGAGAAGGCCCGCCTGGAGGAGGAGCGGGAGAGGAAGCGGAGAGAGCAGGAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AGGAAGTTGGGCCAGATGCGCACTCAGTCCTTAAACCCTGCTCCGTTTTCTCCCCTGACT
XM_005266997.1      AGGAAGTTGGGCCAGATGCGCACTCAGTCCTTAAACCCTGCTCCGTTTTCTCCCCTGACT
NM_001040000.2      AGGAAGTTGGGCCAGATGCGCACTCAGTCCTTAAACCCTGCTCCGTTTTCTCCCCTGACT
XM_005266996.1      AGGAAGTTGGGCCAGATGCGCACTCAGTCCTTAAACCCTGCTCCGTTTTCTCCCCTGACT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GCACAGCAGATGAAGCCCGAAAAGCCTTCCACACTCCAGCGGCCACAGGAAACAGTCATT
XM_005266997.1      GCACAGCAGATGAAGCCCGAAAAGCCTTCCACACTCCAGCGGCCACAGGAAACAGTCATT
NM_001040000.2      GCACAGCAGATGAAGCCCGAAAAGCCTTCCACACTCCAGCGGCCACAGGAAACAGTCATT
XM_005266996.1      GCACAGCAGATGAAGCCCGAAAAGCCTTCCACACTCCAGCGGCCACAGGAAACAGTCATT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CGGGAGCTGCAGCCTCAGCAGCAGCCCCGCACGATCGAGCGCAGAGACTTGCAGTACATT
XM_005266997.1      CGGGAGCTGCAGCCTCAGCAGCAGCCCCGCACGATCGAGCGCAGAGACTTGCAGTACATT
NM_001040000.2      CGGGAGCTGCAGCCTCAGCAGCAGCCCCGCACGATCGAGCGCAGAGACTTGCAGTACATT
XM_005266996.1      CGGGAGCTGCAGCCTCAGCAGCAGCCCCGCACGATCGAGCGCAGAGACTTGCAGTACATT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ACAGTCAGCAAAGAGGAGCTTTCCTCGGGGGACAGTCTGTCCCCCGACCCGTGGAAGCGG
XM_005266997.1      ACAGTCAGCAAAGAGGAGCTTTCCTCGGGGGACAGTCTGTCCCCCGACCCGTGGAAGCGG
NM_001040000.2      ACAGTCAGCAAAGAGGAGCTTTCCTCGGGGGACAGTCTGTCCCCCGACCCGTGGAAGCGG
XM_005266996.1      ACAGTCAGCAAAGAGGAGCTTTCCTCGGGGGACAGTCTGTCCCCCGACCCGTGGAAGCGG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GACGCCAAGGAGAAGCTGGAGAAGCAGCAGCAGATGCACATCGTGGACATGCTGAGCAAG
XM_005266997.1      GACGCCAAGGAGAAGCTGGAGAAGCAGCAGCAGATGCACATCGTGGACATGCTGAGCAAG
NM_001040000.2      GACGCCAAGGAGAAGCTGGAGAAGCAGCAGCAGATGCACATCGTGGACATGCTGAGCAAG
XM_005266996.1      GACGCCAAGGAGAAGCTGGAGAAGCAGCAGCAGATGCACATCGTGGACATGCTGAGCAAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GAGATCCAGGAGCTCCAGAGCAAACCGGACCGCAGCGCCGAGGAGAGCGACCGGCTGCGC
XM_005266997.1      GAGATCCAGGAGCTCCAGAGCAAACCGGACCGCAGCGCCGAGGAGAGCGACCGGCTGCGC
NM_001040000.2      GAGATCCAGGAGCTCCAGAGCAAACCGGACCGCAGCGCCGAGGAGAGCGACCGGCTGCGC
XM_005266996.1      GAGATCCAGGAGCTCCAGAGCAAACCGGACCGCAGCGCCGAGGAGAGCGACCGGCTGCGC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      AAGCTCATGCTGGAGTGGCAGTTCCAGAAGAGACTCCAGGAGTCGAAGCAGAAGGACGAA
XM_005266997.1      AAGCTCATGCTGGAGTGGCAGTTCCAGAAGAGACTCCAGGAGTCGAAGCAGAAGGACGAA
NM_001040000.2      AAGCTCATGCTGGAGTGGCAGTTCCAGAAGAGACTCCAGGAGTCGAAGCAGAAGGACGAA
XM_005266996.1      AAGCTCATGCTGGAGTGGCAGTTCCAGAAGAGACTCCAGGAGTCGAAGCAGAAGGACGAA
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GATGACGAGGAGGAGGAGGACGATGATGTGGACACCATGCTGATCATGCAGCGCCTGGAG
XM_005266997.1      GATGACGAGGAGGAGGAGGACGATGATGTGGACACCATGCTGATCATGCAGCGCCTGGAG
NM_001040000.2      GATGACGAGGAGGAGGAGGACGATGATGTGGACACCATGCTGATCATGCAGCGCCTGGAG
XM_005266996.1      GATGACGAGGAGGAGGAGGACGATGATGTGGACACCATGCTGATCATGCAGCGCCTGGAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GCTGAACGAAGAGCGAGGTTGCAGGACGAGGAGCGGAGGCGGCAGCAGCAGTTAGAAGAG
XM_005266997.1      GCTGAACGAAGAGCGAG------GGACGAGGAGCGGAGGCGGCAGCAGCAGTTAGAAGAG
NM_001040000.2      GCTGAACGAAGAGCGAG------GGACGAGGAGCGGAGGCGGCAGCAGCAGTTAGAAGAG
XM_005266996.1      GCTGAACGAAGAGCGAGGTTGCAGGACGAGGAGCGGAGGCGGCAGCAGCAGTTAGAAGAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ATGCGCAAGCGGGAAGCGGAAGACCGAGCGAGGCAAGAGGAAGAGCGCCGGCGGCAGGAG
XM_005266997.1      ATGCGCAAGCGGGAAGCGGAAGACCGAGCGAGGCAAGAGGAAGAGCGCCGGCGGCAGGAG
NM_001040000.2      ATGCGCAAGCGGGAAGCGGAAGACCGAGCGAGGCAAGAGGAAGAGCGCCGGCGGCAGGAG
XM_005266996.1      ATGCGCAAGCGGGAAGCGGAAGACCGAGCGAGGCAAGAGGAAGAGCGCCGGCGGCAGGAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GAGGAGCGAACAAAACGAGACGCTGAAGAAAAGAGGCGACAGGAAGAAGGGTATTACAGC
XM_005266997.1      GAGGAGCGAACAAAACGAGACGCTGAAGAAAAGAGGCGACAGGAAGAAGGGTATTACAGC
NM_001040000.2      GAGGAGCGAACAAAACGAGACGCTGAAGAAAAGGTTATGGTCCTTTAA------------
XM_005266996.1      GAGGAGCGAACAAAACGAGACGCTGAAGAAAAGAGGCGACAGGAAGAAGGGTATTACAGC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      CGCCTGGAAGCCGAGAGGCGCAGACAGCACGACGAGGCGGCGCGCAGGTTGCTGGAGCCC
XM_005266997.1      CGCCTGGAAGCCGAGAGGCGCAGACAGCACGACGAGGCGGCGCGCAGGTTGCTGGAGCCC
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      CGCCTGGAAGCCGAGAGGCGCAGACAGCACGACGAGGCGGCGCGCAGGTTGCTGGAGCCC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GAGGCGCCCG--------------------------------------------------
XM_005266997.1      GAGGCGCCCGGTCTGTGCCGCCCTCCGCTTCCCCGGGACTACGAGCCCCCGTCCCCGTCC
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      GAGGCGCCCGGTCTGTGCCGCCCTCCGCTTCCCCGGGACTACGAGCCCCCGTCCCCGTCC
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ------------------------------------------------------------
XM_005266997.1      CCCGCGCCCGGCGCCCCTCCTCCCCCGCCTCAGCGAAACGCCTCCTACCTCAAAACACAG
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      CCCGCGCCCGGCGCCCCTCCTCCCCCGCCTCAGCGAAACGCCTCCTACCTCAAAACACAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ------------------------------------------------------------
XM_005266997.1      GTCCTCTCCCCCGACTCGCTGTTCACTGCCAAGTTTGTTGCATACAATGAGGAGGAGGAG
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      GTCCTCTCCCCCGACTCGCTGTTCACTGCCAAGTTTGTTGCATACAATGAGGAGGAGGAG
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      ----------------------GACCAAACTCTTACCCAGGATCTACTGGAGCAGCTGTT
XM_005266997.1      GAGGAGGACTGCAGCCTAGCAGGACCAAACTCTTACCCAGGATCTACTGGAGCAGCTGTT
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      GAGGAGGACTGCAGCCTAGCAGGACCAAACTCTTACCCAGGATCTACTGGAGCAGCTGTT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      GGAGCCCATGACGCCTGTCGGGATGCAAAAGAGAAGCGCTCTAAAAGCCAAGATGCAGAT
XM_005266997.1      GGAGCCCATGACGCCTGTCGGGATGCAAAAGAGAAGCGCTCTAAAAGCCAAGATGCAGAT
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      GGAGCCCATGACGCCTGTCGGGATGCAAAAGAGAAGCGCTCTAAAAGCCAAGATGCAGAT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TCACCTGGAAGTTCTGGGGCCCCTGAAAACTTGACATTCAAGGAACGCCAGCGTCTTTTT
XM_005266997.1      TCACCTGGAAGTTCTGGGGCCCCTGAAAACTTGACATTCAAGGAACGCCAGCGTCTTTTT
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      TCACCTGGAAGTTCTGGGGCCCCTGAAAACTTGACATTCAAGGAACGCCAGCGTCTTTTT
                                                                                

HsCD00534130        ------------------------------------------------------------
NM_001207008.1      TCACAAGGTCAAGATGTATCCAATAAAGTGAAAGCTTCTCGTAAATTAACAGAACTGGAG
XM_005266997.1      TCACAAGGTCAAGATGTATCCAATAAAGTGAAAGCTTCTCGTAAATTAACAGAACTGGAG
NM_001040000.2      ------------------------------------------------------------
XM_005266996.1      TCACAAGGTCAAGATGTATCCAATAAAGTGAAAGCTTCTCGTAAATTAACAGAACTGGAG
                                                                                

HsCD00534130        ---------------------
NM_001207008.1      AATGAACTGAACACAAAGTGA
XM_005266997.1      AATGAACTGAACACAAAGTGA
NM_001040000.2      ---------------------
XM_005266996.1      AATGAACTGAACACAAAGTGA
                                         

Pathways

NCI : PDGFR-beta signaling pathway
NCI : SHP2 signaling
Panther : Alzheimer disease-presenilin pathway
Reactome : Adherens junctions interactions
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Cell-cell junction organization

Protein

SMART domain : PDZ : Domain present in PSD-95, Dlg, and ZO-1/2.
SMART domain : DIL :
Structural Annotation Wiki : NYSGXRC-13165a
HPRD : 01164

Clone

Cloning Information : 487360
HIP Master Clone ID : 402808
Original Clone ID : 13165a14BCt7p1

Experimental

TargetTrack - Experimental data : NYSGXRC-13165a

Organism


TAX_ID : 9606
Species Specific ID: 4301

Genome

Chromosome : 6
Map Location : 6q27
Ensembl : ENSG00000130396

Reagents

Labome : AF6-antibody