DNASU Plasmid Repository • 480.965.5697 | Email

ARF18 (Arabidopsis thaliana Columbia) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARF18
Gene Name:  auxin response factor 18
Sequence             
Original Clone ID: 5566.1.25_GO.18701
Keyword: full-length cds
Species: Arabidopsis thaliana Columbia
Type: cDNA
Vector Name: pDONR221               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
AtCD00534290

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1827nts         Open reading frame : 51 to 1877

ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
ACTTCCAGTCCGCGAGTGTTGAAGGTGATGATGATTTCGGAAGTTCTTCGTCAAGGTCTT
ATCAAGATCAACTATACACAGAGCTATGGAAAGTTTGTGCAGGTCCATTAGTGGAAGTTC
CTCGTGCTCAAGAGAGAGTTTTCTACTTCCCTCAGGGTCACATGGAACAACTTGTGGCGT
CAACTAATCAAGGAATCAATTCAGAAGAAATACCTGTTTTTGATCTTCCTCCAAAGATAC
TTTGTCGAGTTCTTGATGTCACTTTAAAGGCGGAGCATGAAACAGATGAGGTTTACGCTC
AGATCACATTACAACCAGAGGAAGATCAAAGTGAACCAACAAGTCTTGATCCACCTATTG
TTGGACCAACTAAGCAAGAGTTTCATTCGTTTGTTAAGATTTTAACGGCTTCAGATACAA
GCACTCATGGTGGATTCTCTGTTCTTCGTAAACACGCCACTGAATGCTTGCCTTCTTTGG
ATATGGCACAAGCTACTCCTACTCAAGAACTTGTGACTAGAGATCTTCATGGCTTTGAAT
GGAGGTTTAAGCATATATTCAGAGGACAACCACGGAGGCATTTGCTTACTACGGGTTGGA
GTACATTTGTATCCTCGAAAAGACTTGTAGCTGGAGATGCTTTTGTGTTCTTGAGGGGTG
AGAATGGGGATTTACGGGTTGGAGTGAGACGATTAGCTCGGCATCAAAGCACAATGCCTA
CTTCGGTTATTTCAAGTCAGAGCATGCATTTGGGAGTTCTTGCTACAGCTTCTCATGCTG
TGCGTACAACAACAATCTTTGTTGTCTTTTACAAGCCTAGGATAAGCCAATTCATAGTTG
GGGTGAACAAGTATATGGAAGCTATAAAGCATGGATTTTCTCTCGGTACCCGATTCAGAA
TGAGGTTTGAAGGAGAAGAGTCTCCTGAGAGAATATTTACTGGTACGATTGTGGGAAGTG
GAGATCTATCTTCACAATGGCCAGCTTCTAAATGGAGGTCATTGCAGGTACAATGGGATG
AGCCAACAACAGTTCAGAGACCAGATAAAGTCTCACCATGGGAGATAGAGCCTTTCTTGG
CAACTTCCCCAATTTCAACTCCTGCTCAACAACCACAATCGAAATGCAAGCGGTCAAGAC
CCATCGAGCCATCAGTTAAAACACCAGCCCCACCTAGTTTCTTGTACAGCCTCCCTCAGA
GCCAAGATTCCATTAATGCATCCCTTAAACTGTTTCAAGATCCATCACTTGAGAGAATTT
CAGGTGGATACTCCTCAAACAACAGCTTCAAACCCGAGACTCCTCCTCCTCCAACGAATT
GTAGCTATAGGTTGTTTGGATTTGATCTCACAAGCAATTCTCCTGCTCCAATCCCTCAAG
ACAAGCAACCGATGGATACTTGTGGAGCTGCCAAGTGTCAAGAACCCATCACTCCAACCT
CAATGAGTGAGCAGAAGAAGCAACAAACATCAAGAAGTCGAACTAAAGTGCAAATGCAAG
GCATTGCGGTTGGTCGTGCGGTTGATTTAACACTGTTGAAATCTTACGATGAACTGATTG
ATGAGCTTGAGGAGATGTTTGAGATTCAAGGACAGCTTCTTGCCCGAGACAAATGGATCG
TTGTCTTCACTGATGATGAAGGAGATATGATGCTTGCTGGTGATGATCCGTGGAATGAGT
TTTGCAAGATGGCAAAGAAGATATTTATATATTCGAGCGATGAGGTTAAGAAAATGACAA
CGAAACTGAAGATTTCTTCGTCGTTAGAGAATGAGGAATATGGTAATGAATCATTCGAAA
ATCGTAGTAGGGGGTGATAGGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGC
ATTGCTTA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a496g,T166A
                                

5' Linker Sequence:
CCAACTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
TAGGACCCAGCTTTCTTGTACAAAGTTGGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in GO.18701
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site Att P2 Primer 3026 3043
primer site U19 primer 517 535
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
selectable marker KanR kanamycin resistance gene 3156 3965
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARF18
SYNONYM : F21F14.12; auxin response factor 18
GENEID : 825356
Locus Tag : AT3G61830
GI : 18412151
GenBank Accession : NM_116048
TAIR : AT3G61830
Target GenBank: NM_116048

 

Protein

SMART domain : B3 : B3 DNA binding domain
Structural Annotation Wiki : GO.18701

Clone

Cloning Information : 514161
HIP Master Clone ID : 425328
Original Clone ID : 5566.1.25_GO.18701

Experimental

TargetTrack - Experimental data : GO.18701

Organism


TAX_ID : 3702
Species Specific ID: 825356

Genome

Chromosome : 3

Reagents

Labome : ARF18-cDNA