DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pGEn1-DEST


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pGEn1-DEST              
Source: Kelley Moremen
Description: Mammalian expression vector with a CMV promoter and N-terminal TCM 8xHis and Strep tag; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments: Empty vector contains ccdB death cassette, which is removed in constructs containing a gene insert
Publications: None
Authors: University of Georgia
Kelley Moremen

Price:  Login for Pricing
No restriction
Special MTA: SPTA



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pGEn1-DEST

pGEn1-DEST in advanced viewed

Synonyms: pXLG-NtermTCMhisStrep-DEST
Sequencing Primer: Forward:  pGEn3-DEST-5'F
Reverse:  pGEn1-DEST R
Description: Mammalian expression vector with a CMV promoter and N-terminal TCM 8xHis and Strep tag; ampicillin resistance in bacteria; Gateway recombinational cloning
Comments: None
Size (bp): 6210
Parent Vector: None
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: University of Georgia
Kelley Moremen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE Col E1 origin 1137 1804
death cassette ccdB ccdB death cassette (removed in plasmids with insert) 4352 4657
intron artificial intron Artificial Intron 2828 2960
poly-A signal BGH pA bovine growth hormone (BGH) polyadenylation signal 5386 5600
primer forward forward primer 5? AGCATGCACCACCACCATCACC 3? 3049 3070
primer reverse reverse primer 5' TGACAACGGGCCACAACTCCTC 3' 5009 5030
promoter CMV CMV mammalian promoter 2208 2790
recombination site 5'ITR inverted terminal repeat sequence 1998 2127
recombination site attR1 attR1 recombinational cloning site 3114 3242
recombination site attR2 attR2 recombinational cloning site 4698 4822
recombination site 3'-ITR inverted terminal repeat sequence 5688 5817
selectable marker AmpR ampicillin resistance gene 129 1108
selectable marker CmR Chloramphenicol resistance (CmR) gene (removed in plasmids with insert) 3351 4000
signal sequence TCM TCM signal sequence 2977 3054
tag His 8xHis tag 3055 3078
tag strep N-terminal Strep tag 3085 3108
trxn regulatory element WPRE woodchuck hepatitis post-transcriptional regulatory element 4838 5379


Species Specific ID: None
Target GenBank: None