DNASU Plasmid Repository • 480.965.5697 | Email

PRPF19 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRPF19
Gene Name:  pre-mRNA processing factor 19
Sequence             
Original Clone ID: HR2956A-15-136-14.1
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Northeast Structural Genomics Consortium
Rutgers University
HsCD00536023

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 372nts         Open reading frame : 51 to 422

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCCGTGCG
TGAGCCCGGTGAGCAACCATGTGTATGAACGTCGTCTGATTGAAAAATATATTGCGGAAA
ACGGCACCGATCCGATTAATAACCAGCCGCTGAGCGAAGAGCAGCTGATTGATATTAAAG
TGGCGCATCCGATTCGTCCGAAACCGCCGAGCGCGACCAGCATTCTGGCGATTCTGAAAG
CGCTGCAGGATGAATGGGATGCGGTGATGCTGCATAGCTTTACCCTGCGTCAGCAGCTGC
AGACCACCCGTCAGGAACTGAGCCATGCGCTGTATCAGCATGATGCGGCGTGCCGTGTGA
TTGCGCGTCTGACCAAAGAAGTGACCGCGGCGCGTGAAGCGCTGGCGACCCTGAAACCGT
AGCTCGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
c176t,P59L
                                

5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
Find experimental protocols in HR2956A
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRPF19
Symbol Nomenclature : PRPF19
SYNONYM : NMP200; PRP19; PSO4; SNEV; UBOX4; hPSO4
Designation : PRP19/PSO4 homolog|PRP19/PSO4 pre-mRNA processing factor 19 homolog|nuclear matrix protein 200|nuclear matrix protein NMP200 related to splicing factor PRP19|pre-mRNA-processing factor 19|senescence evasion factor
Full Nomenclature : pre-mRNA processing factor 19
GENEID : 27339
GI : 7657381
GenBank Accession : NM_014502
HGNC : 17896
MIM : 608330
Vega : OTTHUMG00000167798
Target GenBank: None

 

Protein

SMART domain : Ubox : Modified RING finger domain
Structural Annotation Wiki : HR2956A
UniProt : Q9UMS4
HPRD : 12214

Clone

Cloning Information : 618619
HIP Master Clone ID : 515600
Original Clone ID : HR2956A-15-136-14.1

Experimental

TargetTrack - Experimental data : HR2956A

Organism


TAX_ID : 9606
Species Specific ID: 27339

Genome

Chromosome : 11
Map Location : 11q12.2
Ensembl : ENSG00000110107

Reagents

Labome : PRPF19-antibody