DNASU Plasmid Repository • 480.965.5697 | Email

VAMP5 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  VAMP5
Gene Name:  vesicle-associated membrane protein 5
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131137.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 351nts         Open reading frame : 1 to 351
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 434
Start on reference sequence 84
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : VAMP5
Symbol Nomenclature : VAMP5
Designation : VAMP-5|myobrevin
Full Nomenclature : vesicle-associated membrane protein 5
GENEID : 10791
Locus Tag : HSPC191
GI : 60821425
GenBank Accession : AY893537
HGNC : 12646
MIM : 607029
Vega : OTTHUMG00000130169
Target GenBank: NM_006634


Reference Sequence Alignment









Panther : 5HT2 type receptor mediated signaling pathway
Panther : 5HT3 type receptor mediated signaling pathway
Panther : 5HT4 type receptor mediated signaling pathway
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Beta3 adrenergic receptor signaling pathway
Panther : Cortocotropin releasing factor receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Ionotropic glutamate receptor pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Panther : Nicotinic acetylcholine receptor signaling pathway
Panther : Opioid prodynorphin pathway
Panther : Opioid proenkephalin pathway
Panther : Opioid proopiomelanocortin pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Reactome : Clathrin derived vesicle budding
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Lysosome Vesicle Biogenesis
Reactome : Membrane Trafficking
Reactome : trans-Golgi Network Vesicle Budding


UniProt : Q9BV40
HPRD : 09513


Cloning Information : 131137
HIP Master Clone ID : 107294
Original Clone ID : FLH131137.01X


TAX_ID : 9606
Species Specific ID: 8673


Chromosome : 2
Map Location : 2p11.2
Ensembl : ENSG00000168899


Labome : VAMP5-antibody