DNASU Plasmid Repository • 480.965.5697 | Email

GUK1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GUK1
Gene Name:  guanylate kinase 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131243.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00005391

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 594nts         Open reading frame : 1 to 594
Reference Sequence Alignment

ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCTG
CTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCACG
AGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGTG
ATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAACCTG
TATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTGCTG
GACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTACATC
TCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACTGAA
ACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAAG
GAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGAG
CTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 600
Start on reference sequence 7
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GUK1
Symbol Nomenclature : GUK1
SYNONYM : GMK
Designation : ATP:GMP phosphotransferase|GMP kinase|guanylate kinase
Full Nomenclature : guanylate kinase 1
GENEID : 2987
Locus Tag : RP11-520H14.2
GI : 60832494
GenBank Accession : AY893976
HGNC : 4693
MIM : 139270
Vega : OTTHUMG00000039503
Target GenBank: U66895

 

Reference Sequence Alignment

  

HsCD00005391        ------------------------------------------------------------
NM_001159391.1      ------------------------------------------------------------
NM_001242839.1      ------------------------------------------------------------
NM_001159390.1      ATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCGGGCCCCACCGGAC
NM_000858.5         ------------------------------------------------------------
                                                                                

HsCD00005391        ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001159391.1      ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001242839.1      ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_001159390.1      GGCATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
NM_000858.5         ---ATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACC
                       *********************************************************

HsCD00005391        CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001159391.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001242839.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_001159390.1      CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
NM_000858.5         CTGCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACC
                    ************************************************************

HsCD00005391        ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001159391.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001242839.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_001159390.1      ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
NM_000858.5         ACGAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAG
                    ************************************************************

HsCD00005391        GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001159391.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001242839.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_001159390.1      GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
NM_000858.5         GTGATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAAC
                    ************************************************************

HsCD00005391        CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001159391.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001242839.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_001159390.1      CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
NM_000858.5         CTGTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTG
                    ************************************************************

HsCD00005391        CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001159391.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001242839.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_001159390.1      CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
NM_000858.5         CTGGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTAC
                    ************************************************************

HsCD00005391        ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001159391.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001242839.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_001159390.1      ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
NM_000858.5         ATCTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACT
                    ************************************************************

HsCD00005391        GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_001159391.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_001242839.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_001159390.1      GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
NM_000858.5         GAAACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGC
                    ************************************************************

HsCD00005391        AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA
NM_001159391.1      AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA
NM_001242839.1      AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA
NM_001159390.1      AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA
NM_000858.5         AAGGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCA
                    ************************************************************

HsCD00005391        GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCGAC
NM_001159391.1      GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA
NM_001242839.1      GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA
NM_001159390.1      GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA
NM_000858.5         GAGCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGA
                    ****************************************************** ..

Pathways

Panther : De novo purine biosynthesis
Reactome : Abacavir metabolism
Reactome : Abacavir transport and metabolism
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Synthesis and interconversion of nucleotide di- and triphosphates

Protein

SMART domain : GuKc : Guanylate kinase homologues.
UniProt : Q16774
UniProt : B4E1H6
UniProt : Q6IBG8
HPRD : 00755

Clone

Cloning Information : 131243
HIP Master Clone ID : 107400
Original Clone ID : FLH131243.01L

Organism


TAX_ID : 9606
Species Specific ID: 2987

Genome

Chromosome : 1
Map Location : 1q32-q41
Ensembl : ENSG00000143774

Reagents

Labome : GUK1-antibody