DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  NPAS2
Gene Name:  neuronal PAS domain protein 2
Sequence             
Original Clone ID: HR3555E-11-157-14.1
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Northeast Structural Genomics Consortium
Rutgers University
HsCD00539920

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 447nts         Open reading frame : 51 to 497
Reference Sequence Alignment

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCGTGCGA
GCCGTAATAAAAGCGAAAAAAAACGTCGTGATCAGTTTAACGTGCTGATTAAAGAACTGA
GCAGCATGCTGCCGGGCAATACCCGTAAAATGGATAAAACCACCGTGCTGGAAAAAGTGA
TTGGCTTTCTGCAGAAGCATAACGAAGTGAGCGCGCAGACCGAAATTTGCGATATTCAGC
AGGATTGGAAACCGAGCTTTCTGAGCAACGAAGAATTTACCCAGCTGATGCTGGAAGCGC
TGGATGGCTTTATTATTGCGGTGACCACCGATGGCAGCATTATTTATGTGAGCGATAGCA
TTACCCCGCTGCTGGGCCATCTGCCGAGCGATGTGATGGATCAGAACCTGCTGAACTTTC
TGCCGGAGCAGGAGCATAGCGAAGTGTATAAAATTCTGAGCAGCCATATGCTGGTGACCG
ATAGCCCGAGCCCGTAGCTCGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTT
GGCTGCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR3555E
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : NPAS2
Symbol Nomenclature : NPAS2
SYNONYM : MOP4; PASD4; bHLHe9
Designation : PAS domain-containing protein 4|basic-helix-loop-helix-PAS protein MOP4|class E basic helix-loop-helix protein 9|member of PAS protein 4|member of PAS superfamily 4|neuronal PAS domain-containing protein 2|neuronal PAS2
Full Nomenclature : neuronal PAS domain protein 2
GENEID : 4862
HGNC : 7895
MIM : 603347
Vega : OTTHUMG00000130675
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
XM_005263960.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
XM_005263953.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
XM_005263954.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
NM_002518.3         ------------------------------------------------------------
XM_005263957.1      ATGTATGCGTATGGTTTTGTTGGGAGATGTGCCCCTTTCCCAGCCGAGGAGGGACGCACC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
XM_005263960.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
XM_005263953.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
XM_005263954.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
NM_002518.3         ------------------------------------------------------------
XM_005263957.1      TTTGACCTTTCTGAAGAGCTGGGCAGGTCGGTAACCAGGGAAGGGACAGGCACCACCCGG
                                                                                

HsCD00539920        ----------------------------------------------------CTTTAAGA
XM_005263959.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
XM_005263960.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
XM_005263953.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
XM_005263954.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
NM_002518.3         ------------------------------------------------------------
XM_005263957.1      CTAAATTCAGAACCAGTCCCGCTCCTCTGCTTGCCACTCCTTAATTGCTCAAGGAAAAAC
                                                                                

HsCD00539920        AGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCGTGCGAGCCGTAAT
XM_005263959.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263960.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263953.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263954.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
NM_002518.3         ---------------ATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
XM_005263957.1      TGCATAGAAAATCTAATGGATGAAGATGAGAAAGACAGAGCCAAGAGAGCTTCTCGAAAC
                                   .   ** *. ** * .*: ****. . *:*.*:** :  **:** 

HsCD00539920        AAAAGCGAAAAAAAACGTCGTGATCAGTTTAACGTGCTGATTAAAGAACTGAGCAGCATG
XM_005263959.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263960.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263953.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263954.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
NM_002518.3         AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
XM_005263957.1      AAGTCTGAGAAGAAGCGTCGGGACCAGTTCAATGTTCTCATCAAAGAGCTCAGTTCCATG
                    **.:  **.**.**.***** ** ***** ** ** ** ** *****.** ** : ****

HsCD00539920        CTGCCGGGCAATACCCGTAAAATGGATAAAACCACCGTGCTGGAAAAAGTGATTGGCTTT
XM_005263959.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263960.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263953.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263954.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
NM_002518.3         CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
XM_005263957.1      CTCCCTGGCAACACGCGGAAAATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTT
                    ** ** ***** ** ** ******** ************ *******.** ** **.***

HsCD00539920        CTGCAGAAGCATAACGAAGTGAGCGCGCAGACCGAAATTTGCGATATTCAGCAGGATTGG
XM_005263959.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263960.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263953.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263954.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
NM_002518.3         TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
XM_005263957.1      TTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGG
                     *******.** ** ***** : .*****.** ***** ** ** ********.** ***

HsCD00539920        AAACCGAGCTTTCTGAGCAACGAAGAATTTACCCAGCTGATGCTGGAAGCGCTGGATGGC
XM_005263959.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263960.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263953.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263954.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
NM_002518.3         AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
XM_005263957.1      AAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGC
                    **.** : .** ** ** ** ******** ************ ****.**. *.******

HsCD00539920        TTTATTATTGCGGTGACCACCGATGGCAGCATTATTTATGTGAGCGATAGCATTACCCCG
XM_005263959.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263960.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263953.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263954.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
NM_002518.3         TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
XM_005263957.1      TTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCT
                    ** ***** **.*****.**.** ******** ** ***** :  ** ** ** ** ** 

HsCD00539920        CTGCTGGGCCATCTGCCGAGCGATGTGATGGATCAGAACCTGCTGAACTTTCTGCCGGAG
XM_005263959.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263960.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263953.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263954.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
NM_002518.3         CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
XM_005263957.1      CTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAA
                    ** ** ** *** *.***:  ***** ***********  ** *.** ** ** **.**.

HsCD00539920        CAGGAGCATAGCGAAGTGTATAAAATTCTGAGCAGCCATATGCTGGTGACCGATAGCCCG
XM_005263959.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263960.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263953.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263954.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
NM_002518.3         CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
XM_005263957.1      CAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCC
                    **.**.***: .***** ******** ** :  : ********* ***** ***: *** 

HsCD00539920        AGCCCG------------------------------------------------------
XM_005263959.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263960.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAG--------------------------
XM_005263953.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263954.1      TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
NM_002518.3         TCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGC
XM_005263957.1      TCCCCAGAATACTTAAAATTGCCTAGCCCCTCCTG-------------------------
                    : ***.                                                      

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263954.1      AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
NM_002518.3         AGCTTGAACCCAAAGGAATTTCCAACTTATGAATACATAAAATTTGTAGGAAATTTTCGC
XM_005263957.1      ------------------------------------------------------------
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263954.1      TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
NM_002518.3         TCTTACAACAATGTGCCTAGCCCCTCCTGTAATGGTTTTGACAACACCCTTTCAAGACCT
XM_005263957.1      -----------------------------TAATGGTTTTGACAACACCCTTTCAAGACCT
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263954.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
NM_002518.3         TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
XM_005263957.1      TGCCGGGTGCCACTAGGAAAGGAGGTTTGCTTCATTGCCACCGTTCGTCTGGCAACACCA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263960.1      -AGTTTTATTGCCATCTTCTCAGAGGCAGCTTGAACCCAAAGGAATTTCCAACTTATGAA
XM_005263953.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263954.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
NM_002518.3         CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
XM_005263957.1      CAATTCTTAAAGGAAATGTGCATAGTTGACGAACCTTTAGAGGAATTCACTTCAAGGCAT
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263960.1      TACATAAAATTTGTAGGAAATTTTCG----------------------------------
XM_005263953.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263954.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
NM_002518.3         AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
XM_005263957.1      AGCTTGGAATGGAAATTTTTATTTCTGGATCACAGAGCACCTCCAATCATAGGATACCTG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263960.1      ------------------------------------------------------------
XM_005263953.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263954.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
NM_002518.3         CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
XM_005263957.1      CCTTTTGAAGTGCTGGGAACCTCAGGCTATGACTACTACCACATTGATGACCTGGAGCTC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263960.1      --------CTCTTACAACAATGTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263953.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263954.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
NM_002518.3         CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
XM_005263957.1      CTGGCCAGGTGTCACCAGCACCTGATGCAGTTTGGCAAAGGGAAGTCGTGTTGCTACCGG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263960.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263953.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263954.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
NM_002518.3         TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
XM_005263957.1      TTTCTGACCAAAGGTCAGCAGTGGATCTGGCTGCAGACTCACTACTACATCACCTACCAT
                                                                                

HsCD00539920        ---------------------------------------------------TAGCTCGAG
XM_005263959.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263960.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263953.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263954.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
NM_002518.3         CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
XM_005263957.1      CAGTGGAACTCCAAGCCCGAGTTCATCGTGTGCACACACTCGGTGGTCAGTTACGCAGAT
                                                                       **   .** 

HsCD00539920        ATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTG---------------
XM_005263959.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263960.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263953.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263954.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
NM_002518.3         GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
XM_005263957.1      GTCCGGGTGGAAAGGAGGCAGGAGCTGGCTCTGGAAGACCCGCCATCCGAGGCCCTCCAC
                    .***** ** :** .*.**. **.. *.. ***..: . * ** .               

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263960.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263953.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263954.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
NM_002518.3         TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
XM_005263957.1      TCCTCAGCACTAAAGGACAAGGGCTCAAGCCTGGAACCTCGGCAGCACTTTAACACACTC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263960.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263953.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263954.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
NM_002518.3         GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
XM_005263957.1      GACGTGGGTGCCTCGGGCCTTAATACCAGTCATTCGCCATCGGCGTCCTCAAGAAGTTCC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263960.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263953.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263954.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
NM_002518.3         CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
XM_005263957.1      CACAAATCCTCGCACACAGCCATGTCAGAACCCACCTCCACTCCCACCAAGCTGATGGCA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263960.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263953.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263954.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
NM_002518.3         GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
XM_005263957.1      GAGGCCAGCACCCCGGCTTTGCCAAGATCAGCCACCCTGCCCCAAGAGTTACCTGTCCCC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263960.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263953.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263954.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
NM_002518.3         GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
XM_005263957.1      GGGCTCAGCCAGGCAGCCACCATGCCGGCCCCTCTGCCTTCCCCATCGTCCTGCGACCTC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263960.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263953.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263954.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
NM_002518.3         ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
XM_005263957.1      ACACAGCAGCTCCTGCCTCAGACCGTTCTGCAGAGCACGCCCGCTCCCATGGCACAGTTT
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263960.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263953.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263954.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
NM_002518.3         TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
XM_005263957.1      TCGGCACAGTTCAGCATGTTCCAGACCATCAAAGACCAGCTAGAGCAGCGGACGCGGATC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263960.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263953.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263954.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
NM_002518.3         CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
XM_005263957.1      CTGCAGGCCAATATCCGGTGGCAACAGGAAGAGCTCCACAAGATCCAGGAGCAGCTCTGC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263960.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263953.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263954.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
NM_002518.3         CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
XM_005263957.1      CTGGTCCAGGACTCCAACGTCCAGATGTTCCTGCAGCAGCCAGCTGTATCCCTGAGCTTC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263960.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263953.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263954.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
NM_002518.3         AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
XM_005263957.1      AGCAGCACCCAGCGACCTGAGGCTCAGCAGCAGCTACAGCAAAGGTCAGCTGCAGTGACT
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263960.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263953.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263954.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
NM_002518.3         CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
XM_005263957.1      CAGCCCCAGCTCGGGGCGGGCCCCCAACTTCCAGGGCAGATCTCCTCTGCCCAGGTCACA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263960.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263953.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263954.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
NM_002518.3         AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
XM_005263957.1      AGCCAGCACCTGCTCAGAGAATCAAGTGTGATATCAACCCAGGGTCCAAAGCCAATGAGA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263960.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263953.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263954.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
NM_002518.3         AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
XM_005263957.1      AGCTCACAGCTAATGCAGAGCAGCGGCCGCTCTGGAAGCAGCCTAGTGTCCCCGTTCAGC
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263960.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263953.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263954.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
NM_002518.3         AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
XM_005263957.1      AGCGCCACAGCTGCGCTCCCGCCAAGTCTGAATCTGACCACACCTGCTTCCACCTCCCAG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263960.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263953.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263954.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
NM_002518.3         GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
XM_005263957.1      GATGCCAGCCAGTGCCAGCCCAGCCCAGACTTCAGCCATGATCGGCAGCTCAGGCTGTTG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263960.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263953.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263954.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
NM_002518.3         CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
XM_005263957.1      CTGAGCCAGCCCATCCAGCCCATGATGCCCGGGTCCTGTGACGCAAGGCAGCCCTCGGAA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263960.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263953.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263954.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
NM_002518.3         GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
XM_005263957.1      GTCAGCAGGACGGGACGGCAAGTCAAGTACGCCCAGAGCCAGACCGTGTTTCAAAATCCA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263960.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263953.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263954.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
NM_002518.3         GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
XM_005263957.1      GACGCACACCCCGCCAACAGCAGCAGCGCCCCGATGCCCGTCCTGCTGATGGGGCAGGCG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263960.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263953.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263954.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
NM_002518.3         GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
XM_005263957.1      GTGCTCCACCCCAGCTTCCCTGCCTCCCAACCATCGCCCCTGCAGCCTGCACAGGCCCGG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      CAGCAGCCACCGCAGCACTACCTGCAGGTTCTTGGGCACACTCTATAG------------
XM_005263960.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263953.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263954.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTTCTTGG
NM_002518.3         CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
XM_005263957.1      CAGCAGCCACCGCAGCACTACCTGCAGGTACAGGCACCAACCTCTTTGCACAGTGAGCAG
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      ------------------------------------------------------------
XM_005263960.1      CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263953.1      CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263954.1      GCACACTCTATAGCCATACTGGACAGGAACCAGGTGCCCCGTGTAGGCATCGTCGGTCGG
NM_002518.3         CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
XM_005263957.1      CAGGACTCGCTACTTCTCTCCACCTACTCACAACAGCCAGGGACCCTGGGCTACCCCCAA
                                                                                

HsCD00539920        ------------------------------------------------------------
XM_005263959.1      ------------------------------------------------------------
XM_005263960.1      CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263953.1      CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263954.1      TTTGCCGTCAGAGATGGCGCATCTCGCTGCATCCCCCGAGAGTACACCGGTTGCTCTAGC
NM_002518.3         CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
XM_005263957.1      CCACCCCCAGCACAGCCCCAGCCCCTACGTCCTCCCCGAAGGGTCAGCAGTCTGTCTGAG
                                                                                

HsCD00539920        ------------------------------
XM_005263959.1      ------------------------------
XM_005263960.1      TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
XM_005263953.1      TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
XM_005263954.1      CACCTGCGGCCCGCCCATCTGCGCTAG---
NM_002518.3         TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
XM_005263957.1      TCGTCAGGCCTCCAGCAGCCGCCCCGATAA
                                                  

Protein

SMART domain : PAS : PAS domain
SMART domain : HLH : helix loop helix domain
Structural Annotation Wiki : HR3555E
HPRD : 09137

Clone

Cloning Information : 619971
HIP Master Clone ID : 516952
Original Clone ID : HR3555E-11-157-14.1

Experimental

TargetTrack - Experimental data : HR3555E

Organism


TAX_ID : 9606
Species Specific ID: None

Genome

Chromosome : 2
Map Location : 2q11.2
Ensembl : ENSG00000170485