DNASU Plasmid Repository • 480.965.5697 | Email

PRELP (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRELP
Gene Name:  proline/arginine-rich end leucine-rich repeat protein
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131019.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00005441

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1149nts         Open reading frame : 1 to 1149
Reference Sequence Alignment

ATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGC
CAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCC
AGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCT
CCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCC
CCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATC
CCGCCCCGCATCCATTACCTCTATCTCCAGAGCAACTTCATCACTGAGCTCCCGGTGGAG
TCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAG
ATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAAC
CAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAG
AACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTG
GATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTC
AAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTC
CCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGA
TACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGAC
AGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCAC
AACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAAC
AATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCAT
GACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAAC
TACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTG
GTCATCGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1267
Start on reference sequence 119
Mutations:
None
Discrepancy:
a332g,N111S
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRELP
Symbol Nomenclature : PRELP
SYNONYM : MST161; MSTP161; SLRR2A
Designation : 55 kDa leucine-rich repeat protein of articular cartilage|prolargin|prolargin proteoglycan|proline-arginine-rich end leucine-rich repeat protein
Full Nomenclature : proline/arginine-rich end leucine-rich repeat protein
GENEID : 5549
Locus Tag : RP11-91B9.1
GI : 60833266
GenBank Accession : AY894006
HGNC : 9357
MIM : 601914
Vega : OTTHUMG00000035911
Target GenBank: BC032498

 

Reference Sequence Alignment

  

HsCD00005441      ATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGC
NM_201348.1       ATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGC
NM_002725.3       ATGAGGTCACCCCTCTGCTGGCTCCTCCCACTTCTCATCTTGGCCTCAGTGGCCCAAGGC
                  ************************************************************

HsCD00005441      CAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCC
NM_201348.1       CAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCC
NM_002725.3       CAGCCAACAAGACGACCAAGACCCGGGACTGGGCCCGGGCGCAGACCCAGGCCCAGGCCC
                  ************************************************************

HsCD00005441      AGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCT
NM_201348.1       AGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCT
NM_002725.3       AGGCCCACACCCAGCTTTCCTCAGCCTGATGAACCAGCAGAGCCAACAGACCTGCCTCCT
                  ************************************************************

HsCD00005441      CCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCC
NM_201348.1       CCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCC
NM_002725.3       CCCCTCCCTCCAGGCCCTCCATCTATCTTCCCTGACTGTCCCCGCGAATGCTACTGCCCC
                  ************************************************************

HsCD00005441      CCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATC
NM_201348.1       CCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATC
NM_002725.3       CCTGATTTCCCATCTGCCCTCTACTGTGATAGCCGCAACCTGCGAAAGGTCCCTGTCATC
                  ************************************************************

HsCD00005441      CCGCCCCGCATCCATTACCTCTATCTCCAGAGCAACTTCATCACTGAGCTCCCGGTGGAG
NM_201348.1       CCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAG
NM_002725.3       CCGCCCCGCATCCATTACCTCTATCTCCAGAACAACTTCATCACTGAGCTCCCGGTGGAG
                  *******************************.****************************

HsCD00005441      TCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAG
NM_201348.1       TCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAG
NM_002725.3       TCCTTCCAGAATGCCACAGGCCTGCGATGGATTAACCTGGACAACAACCGAATCCGCAAG
                  ************************************************************

HsCD00005441      ATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAAC
NM_201348.1       ATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAAC
NM_002725.3       ATAGACCAGAGGGTGCTGGAGAAACTGCCCGGCCTGGTGTTCCTCTACATGGAGAAGAAC
                  ************************************************************

HsCD00005441      CAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAG
NM_201348.1       CAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAG
NM_002725.3       CAGTTGGAAGAGGTCCCCTCGGCCCTGCCCCGGAACCTGGAGCAGCTGAGGCTGAGCCAG
                  ************************************************************

HsCD00005441      AACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTG
NM_201348.1       AACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTG
NM_002725.3       AACCACATCTCCAGAATCCCGCCTGGTGTCTTCAGCAAGCTGGAGAACCTGCTGCTCCTG
                  ************************************************************

HsCD00005441      GATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTC
NM_201348.1       GATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTC
NM_002725.3       GATCTCCAGCACAACAGGCTGAGCGACGGCGTCTTCAAGCCCGACACCTTCCATGGCCTC
                  ************************************************************

HsCD00005441      AAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTC
NM_201348.1       AAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTC
NM_002725.3       AAGAACCTCATGCAGCTCAACCTGGCCCACAACATCCTGAGAAAGATGCCGCCCAGGGTC
                  ************************************************************

HsCD00005441      CCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGA
NM_201348.1       CCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGA
NM_002725.3       CCCACCGCCATTCACCAGCTCTACCTGGACAGTAACAAGATTGAGACCATCCCTAACGGA
                  ************************************************************

HsCD00005441      TACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGAC
NM_201348.1       TACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGAC
NM_002725.3       TACTTCAAGAGCTTTCCCAATCTTGCCTTCATTCGGCTTAACTACAACAAGCTGACAGAC
                  ************************************************************

HsCD00005441      AGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCAC
NM_201348.1       AGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCAC
NM_002725.3       AGGGGACTCCCCAAGAACTCCTTTAATATCTCCAACCTGCTTGTGCTCCACCTGTCCCAC
                  ************************************************************

HsCD00005441      AACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAAC
NM_201348.1       AACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAAC
NM_002725.3       AACAGGATCAGCAGTGTGCCCGCCATCAACAACAGGCTGGAACACCTGTACCTCAACAAC
                  ************************************************************

HsCD00005441      AATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCAT
NM_201348.1       AATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCAT
NM_002725.3       AATAGCATCGAGAAAATCAACGGAACCCAGATTTGCCCCAACGACCTAGTGGCGTTCCAT
                  ************************************************************

HsCD00005441      GACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAAC
NM_201348.1       GACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAAC
NM_002725.3       GACTTCTCCTCGGACCTGGAGAACGTGCCACACCTGCGCTACCTGCGGCTGGATGGAAAC
                  ************************************************************

HsCD00005441      TACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTG
NM_201348.1       TACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTG
NM_002725.3       TACTTGAAGCCGCCCATCCCGCTGGACCTCATGATGTGCTTCCGCCTCCTGCAGTCCGTG
                  ************************************************************

HsCD00005441      GTCATCGAC
NM_201348.1       GTCATCTAG
NM_002725.3       GTCATCTAG
                  ****** * 

Pathways

Reactome : Disease
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : Keratan sulfate biosynthesis
Reactome : Keratan sulfate degradation
Reactome : Keratan sulfate/keratin metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora

Protein

SMART domain : LRRNT : Leucine rich repeat N-terminal domain
UniProt : P51888
UniProt : Q6FG38
HPRD : 03556

Clone

Cloning Information : 131019
HIP Master Clone ID : 107176
Original Clone ID : FLH131019.01L

Organism


TAX_ID : 9606
Species Specific ID: 5549

Genome

Chromosome : 1
Map Location : 1q32
Ensembl : ENSG00000188783

Reagents

Labome : PRELP-antibody