DNASU Plasmid Repository • 480.965.5697 | Email

RPA3 (Homo sapiens) in pSpeedET (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPA3
Gene Name:  replication protein A3, 14kDa
Sequence             
Original Clone ID: 92845
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pSpeedET               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Joint Center for Structural Genomics
PSI:Biology
HsCD00547444

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 366nts         Open reading frame : 51 to 416

CTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGCATGGTGGACA
TGATGGACTTGCCCAGGTCGCGCATCAACGCCGGCATGCTAGCTCAATTCATCGACAAGC
CTGTCTGCTTCGTAGGGAGGCTGGAAAAGATTCATCCCACCGGAAAAATGTTTATTCTTT
CAGATGGAGAAGGAAAAAATGGAACCATCGAGTTGATGGAACCCCTTGATGAAGAAATCT
CTGGAATTGTGGAAGTGGTTGGAAGAGTAACCGCCAAGGCCACCATCTTGTGTACATCTT
ATGTCCAGTTTAAAGAAGATAGCCATCCTTTTGATCTTGGACTTTACAATGAAGCTGTGA
AAATTATCCATGACTTCCCTCAGTTTTATCCTTTAGGGATTGTGCAACATGATTAACGCG
ACTTAATTAACTCGTTTAAACGGTCTCCAGCTTGGCTGTTTTGGCGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCACGAAAACCTGTACTTCCAGGGC

3' Linker Sequence:
TAA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in 421798
Recommended expression in: HK100
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSpeedET

pSpeedET in advanced viewed

Synonyms: pSpeed-ET
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHHENLYFQG tag; kanamycin resistance; PIPE cloning.
Comments: If this vector contains an insert, the ccdB death cassette will not be present.
Size (bp): 5464
Parent Vector: None
Empty Vector: EvNO00285791
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: PMID: 18004753
Title: Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type origin of replication 3306 3988
inducible trxn activator protein gene araC araC coding sequence 4563 5438
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 1596 1805
promoter araC araC promoter 256 285
promoter T7 T7 promoter 290 310
protease cleavage site TEV TEV protease cleavage site 382 402
selectable marker CmR chloramphenicol resistance gene (CmR) (lost in with-insert form) 502 1158
selectable marker KanR kanamycin resistance gene 2396 3208
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn termination sequence rrnB rrnB T2 transcription terminator 2258 2284

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPA3
Symbol Nomenclature : RPA3
SYNONYM : REPA3
Designation : RF-A protein 3|RP-A p14|replication factor A protein 3|replication protein A 14 kDa subunit
Full Nomenclature : replication protein A3, 14kDa
GENEID : 6119
GI : 14602691
GenBank Accession : BC009868
HGNC : 10291
MIM : 179837
Target GenBank: BC009868

 

Pathways

Panther : Cell cycle
Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Assembly of the RAD51-ssDNA nucleoprotein complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : Double-Strand Break Repair
Reactome : Dual incision reaction in GG-NER
Reactome : Extension of Telomeres
Reactome : Formation of incision complex in GG-NER
Reactome : G1/S Transition
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : HSF1 activation
Reactome : Homologous DNA pairing and strand exchange
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Lagging Strand Synthesis
Reactome : M/G1 Transition
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : Nucleotide Excision Repair
Reactome : Presynaptic phase of homologous DNA pairing and strand exchange
Reactome : Processing of DNA double-strand break ends
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication
WikiPathway : G1 to S cell cycle control

Protein

Structural Annotation Wiki : 421798
HPRD : 01567

Clone

Cloning Information : 624380
Original Clone ID : 92845

Experimental

TargetTrack - Experimental data : 421798

Organism


TAX_ID : 9606
Species Specific ID: 6119

Genome

Chromosome : 7
Map Location : 7p22

Reagents

Labome : RPA3-antibody