DNASU Plasmid Repository • 480.965.5697 | Email

SQSTM1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SQSTM1
Gene Name:  sequestosome 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH020997.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000550

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1323nts         Open reading frame : 1 to 1323
Reference Sequence Alignment

ATGGCGTCGCTCACCGTGAAGGCCTACCTTCTGGGCAAGGAGGACGCGGCGCGCGAGATT
CGCCGCTTCAGCTTCTGCTGCAGCCCCGAGCCTGAGGCGGAAGCCGAGGCTGCGGCGGGT
CCGGGACCCTGCGAGCGGCTGCTGAGCCGGGTGGCCGCCCTGTTCCCCGCGCTGCGGCCT
GGCGGCTTCCAGGCGCACTACCGCGATGAGGACGGGGACTTGGTTGCCTTTTCCAGTGAC
GAGGAATTGACAATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAA
GAGAAAAAAGAGTGCCGGCGGGACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAAC
ATGGTGCACCCCAATGTGATCTGCGATGGCTGCAATGGGCCTGTGGTAGGAACCCGCTAC
AAGTGCAGCGTCTGCCCAGACTACGACTTGTGTAGCGTCTGCGAGGGAAAGGGCTTGCAC
CGGGGGCACACCAAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCTGAGGGCTTCTCG
CACAGCCGCTGGCTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAAATG
GGTCCACCAGGAAACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCC
ACGGCAGAATCAGCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTT
GGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAG
CACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAG
AAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGATCCCAGCAAGCCGGGTGGGAATGTT
GAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGAAAGATCGCCTTGGAGTCCGAGGGG
TGCCCTGAGGAACAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCAT
CTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAA
TCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCT
GCCTTGTACCCACATCTCCCGCCAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAG
ATGCTGTCCATGGGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAG
AACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTG
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1375
Start on reference sequence 53
Mutations:
None
Discrepancy:
c876t; g936a; c961t,R321C
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SQSTM1
Symbol Nomenclature : SQSTM1
SYNONYM : A170; OSIL; PDB3; ZIP3; p60; p62; p62B
Designation : EBI3-associated protein of 60 kDa|EBI3-associated protein p60|EBIAP|oxidative stress induced like|phosphotyrosine independent ligand for the Lck SH2 domain p62|phosphotyrosine-independent ligand for the Lck SH2 domain of 62 kDa|sequestosome-1|ubiquitin-binding protein p62
Full Nomenclature : sequestosome 1
GENEID : 8878
GI : 61366122
GenBank Accession : AY890879
HGNC : 11280
MIM : 601530
Vega : OTTHUMG00000150643
Target GenBank: NM_003900

 

Reference Sequence Alignment

  

HsCD00000550      ATGGCGTCGCTCACCGTGAAGGCCTACCTTCTGGGCAAGGAGGACGCGGCGCGCGAGATT
NM_003900.4       ATGGCGTCGCTCACCGTGAAGGCCTACCTTCTGGGCAAGGAGGACGCGGCGCGCGAGATT
                  ************************************************************

HsCD00000550      CGCCGCTTCAGCTTCTGCTGCAGCCCCGAGCCTGAGGCGGAAGCCGAGGCTGCGGCGGGT
NM_003900.4       CGCCGCTTCAGCTTCTGCTGCAGCCCCGAGCCTGAGGCGGAAGCCGAGGCTGCGGCGGGT
                  ************************************************************

HsCD00000550      CCGGGACCCTGCGAGCGGCTGCTGAGCCGGGTGGCCGCCCTGTTCCCCGCGCTGCGGCCT
NM_003900.4       CCGGGACCCTGCGAGCGGCTGCTGAGCCGGGTGGCCGCCCTGTTCCCCGCGCTGCGGCCT
                  ************************************************************

HsCD00000550      GGCGGCTTCCAGGCGCACTACCGCGATGAGGACGGGGACTTGGTTGCCTTTTCCAGTGAC
NM_003900.4       GGCGGCTTCCAGGCGCACTACCGCGATGAGGACGGGGACTTGGTTGCCTTTTCCAGTGAC
                  ************************************************************

HsCD00000550      GAGGAATTGACAATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAA
NM_003900.4       GAGGAATTGACAATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAA
                  ************************************************************

HsCD00000550      GAGAAAAAAGAGTGCCGGCGGGACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAAC
NM_003900.4       GAGAAAAAAGAGTGCCGGCGGGACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAAC
                  ************************************************************

HsCD00000550      ATGGTGCACCCCAATGTGATCTGCGATGGCTGCAATGGGCCTGTGGTAGGAACCCGCTAC
NM_003900.4       ATGGTGCACCCCAATGTGATCTGCGATGGCTGCAATGGGCCTGTGGTAGGAACCCGCTAC
                  ************************************************************

HsCD00000550      AAGTGCAGCGTCTGCCCAGACTACGACTTGTGTAGCGTCTGCGAGGGAAAGGGCTTGCAC
NM_003900.4       AAGTGCAGCGTCTGCCCAGACTACGACTTGTGTAGCGTCTGCGAGGGAAAGGGCTTGCAC
                  ************************************************************

HsCD00000550      CGGGGGCACACCAAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCTGAGGGCTTCTCG
NM_003900.4       CGGGGGCACACCAAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCTGAGGGCTTCTCG
                  ************************************************************

HsCD00000550      CACAGCCGCTGGCTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAAATG
NM_003900.4       CACAGCCGCTGGCTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAAATG
                  ************************************************************

HsCD00000550      GGTCCACCAGGAAACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCC
NM_003900.4       GGTCCACCAGGAAACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCC
                  ************************************************************

HsCD00000550      ACGGCAGAATCAGCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTT
NM_003900.4       ACGGCAGAATCAGCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTT
                  ************************************************************

HsCD00000550      GGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAG
NM_003900.4       GGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAG
                  ************************************************************

HsCD00000550      CACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAG
NM_003900.4       CACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAG
                  ************************************************************

HsCD00000550      AAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGATCCCAGCAAGCCGGGTGGGAATGTT
NM_003900.4       AAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTT
                  *********************************** ************************

HsCD00000550      GAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGAAAGATCGCCTTGGAGTCCGAGGGG
NM_003900.4       GAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGG
                  ***********************************.************************

HsCD00000550      TGCCCTGAGGAACAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCAT
NM_003900.4       CGCCCTGAGGAACAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCAT
                   ***********************************************************

HsCD00000550      CTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAA
NM_003900.4       CTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAA
                  ************************************************************

HsCD00000550      TCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCT
NM_003900.4       TCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCT
                  ************************************************************

HsCD00000550      GCCTTGTACCCACATCTCCCGCCAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAG
NM_003900.4       GCCTTGTACCCACATCTCCCGCCAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAG
                  ************************************************************

HsCD00000550      ATGCTGTCCATGGGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAG
NM_003900.4       ATGCTGTCCATGGGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAG
                  ************************************************************

HsCD00000550      AACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTG
NM_003900.4       AACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTG
                  ************************************************************

HsCD00000550      TTG
NM_003900.4       TGA
                  * .

Pathways

NCI : IL1-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : TNF receptor signaling pathway
NCI : p75(NTR)-mediated signaling
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Interleukin-1 signaling
Reactome : NF-kB is activated and signals survival
Reactome : NRIF signals cell death from the nucleus
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR recruits signalling complexes
Reactome : p75NTR signals via NF-kB
WikiPathway : IL-1 signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy

Clone

Cloning Information : 20997
HIP Master Clone ID : 39557
Original Clone ID : FLH020997.01L

Organism


TAX_ID : 9606
Species Specific ID: 8878

Genome

Chromosome : 5
Map Location : 5q35
Ensembl : ENSG00000161011

Reagents

Labome : SQSTM1-antibody