DNASU Plasmid Repository • 480.965.5697 | Email

POLR2C (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  POLR2C
Gene Name:  polymerase (RNA) II (DNA directed) polypeptide C, 33kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131207.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 828nts        
Open reading frame : 1 to 828
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
Start on reference sequence 58
End on reference sequence 885
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : POLR2C
Symbol Nomenclature : POLR2C
Designation : DNA-directed RNA polymerase II 33 kDa polypeptide|DNA-directed RNA polymerase II subunit C|DNA-directed RNA polymerase II subunit RPB3|RNA polymerase II subunit 3|RNA polymerase II subunit B3|RPB33
Full Nomenclature : polymerase (RNA) II (DNA directed) polypeptide C, 33kDa
GENEID : 5432
Locus Tag : A-152E5.7
GI : 60823188
GenBank Accession : AY893598
HGNC : 9189
MIM : 180663
Vega : OTTHUMG00000133464
Target GenBank: NM_032940


Reference Sequence Alignment




                  ***************************************************** ******













Panther : General transcription regulation
Panther : Transcription regulation by bZIP transcription factor
Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Disease
Reactome : DNA Repair
Reactome : Dual incision reaction in TC-NER
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Formation of transcription-coupled NER (TC-NER) repair complex
Reactome : Gene Expression
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV Transcription Initiation
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : Late Phase of HIV Life Cycle
Reactome : MicroRNA (miRNA) biogenesis
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway
Reactome : Nucleotide Excision Repair
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Regulatory RNA pathways
Reactome : RNA Pol II CTD phosphorylation and interaction with CE
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcription-coupled NER (TC-NER)
Reactome : Viral Messenger RNA Synthesis
WikiPathway : Epithelium TarBase
WikiPathway : Eukaryotic Transcription Initiation
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Squamous cell TarBase


SMART domain : RPOLD : RNA polymerases D
UniProt : P19387
UniProt : Q6FGR6
HPRD : 15945


Cloning Information : 131207
HIP Master Clone ID : 107364
Original Clone ID : FLH131207.01X


TAX_ID : 9606
Species Specific ID: 5432


Chromosome : 16
Map Location : 16q13-q21
Ensembl : ENSG00000102978


Labome : POLR2C-antibody