DNASU Plasmid Repository • 480.965.5697 | Email

HIST2H2AA (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HIST2H2AA3
Gene Name:  histone cluster 2, H2aa3
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130836.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00005526

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 393nts         Open reading frame : 1 to 393
Reference Sequence Alignment

ATGTCTGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCC
CGCGCTGGCCTTCAGTTCCCGGTAGGGCGAGTGCATCGCTTGCTGCGCAAAGGCAACTAC
GCGGAGCGAGTGGGGGCCGGCGCGCCCGTCTACATGGCTGCGGTCCTCGAGTATCTGACC
GCCGAGATCCTGGAGCTGGCGGGCAACGCGGCTCGGGACAACAAGAAGACGCGCATCATC
CCTCGTCACCTCCAGCTGGCCATCCGCAACGACGAGGAACTGAACAAGCTGCTGGGCAAA
GTCACCATCGCCCAGGGCGGCGTCTTGCCTAACATCCAGGCCGTACTGCTCCCTAAGAAG
ACGGAGAGTCACCACAAGGCAAAGGGCAAGGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 431
Start on reference sequence 39
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HIST2H2AA3
Symbol Nomenclature : HIST2H2AA3
SYNONYM : H2A; H2A.2; H2A/O; H2A/q; H2AFO; H2a-615; HIST2H2AA
Designation : H2A histone family, member O|histone 2, H2aa3|histone H2A type 2-A
Full Nomenclature : histone cluster 2, H2aa3
GENEID : 8337
GI : 60834381
GenBank Accession : AY894054
HGNC : 4736
MIM : 142720
Target GenBank: BC001629

 

Reference Sequence Alignment

  

HsCD00005526        ATGTCTGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCC
NM_003510.2         ATGTCGGGACGTGGCAAGCAGGGCGGCAAAGCTCGCGCCAAGGCTAAGACCCGTTCTTCA
NM_003513.2         ATGTCTGGTCGCGGCAAACAAGGCGGTAAAGCTCGCGCCAAGGCTAAGACTCGGTCTTCT
NM_033445.2         ATGTCCGGTCGTGGTAAGCAGGGTGGCAAGGCGCGCGCCAAGGCTAAGTCGCGCTCGTCG
NM_003512.3         ATGTCTGGACGTGGTAAGCAAGGAGGCAAAGCTCGCGCCAAAGCGAAATCCCGCTCTTCT
NM_170745.3         ATGTCTGGACGAGGGAAGCAGGGAGGAAAAGCACGCGCCAAGTCTAAGTCTCGCTCTTCT
NM_021064.4         ATGTCTGGACGTGGCAAGCAGGGAGGCAAAGCCCGCGCTAAGGCCAAGACTCGCTCTTCT
NM_003511.2         ATGTCGGGACGCGGCAAGCAGGGAGGCAAAGCTCGCGCCAAAGCCAAGACCCGCTCTTCT
NM_002105.2         ATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCG
NM_021065.3         ATGTCCGGACGCGGCAAGCAAGGCGGAAAGGCCCGAGCTAAGGCTAAGACCCGCTCTTCG
NM_003516.2         ATGTCTGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCC
NM_175065.2         ATGTCAGGACGCGGAAAGCAGGGAGGCAAGGCCCGCGCTAAGGCCAAGTCGCGCTCGTCC
NM_003517.2         ATGTCTGGTCGTGGCAAACAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCC
NM_001040874.1      ATGTCTGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCC
NM_021052.2         ATGTCTGGACGTGGAAAGCAAGGCGGCAAAGCTCGGGCAAAAGCTAAAACGCGTTCTTCC
NM_003509.2         ATGTCTGGGCGTGGCAAGCAGGGAGGCAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCT
NM_003514.2         ATGTCTGGACGTGGCAAGCAGGGCGGCAAGGCTCGCGCCAAGGCCAAAACCCGCTCCTCT
NM_177925.3         ATGTCCGGTCGCGGGAAACAGGGCGGCAAAGTGCGAGCAAAGGCCAAATCCCGCTCCTCC
NM_021066.2         ATGTCTGGGCGTGGTAAGCAGGGAGGCAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCT
NM_080596.2         ATGTCTGGACGTGGCAAGCAAGGCGGTAAAGCTCGCGCCAAGGCCAAGACCCGCTCTTCT
                    ***** ** ** ** **... ** ** **.*  ** ** **. * **.:* ** ** ** 

HsCD00005526        CGCGCTGGCCTTCAGTTCCCGGTAGGGCGAGTGCATCGCTTGCTGCGCAAAGGCAACTAC
NM_003510.2         AGGGCGGGTCTTCAGTTCCCAGTGGGCCGAGTGCACCGACTGCTCCGCAAGGGCAACTAC
NM_003513.2         CGTGCAGGTTTGCAGTTTCCTGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTAC
NM_033445.2         CGCGCGGGGCTGCAGTTCCCCGTGGGCCGCGTGCACCGGTTGCTCCGCAAGGGCAACTAT
NM_003512.3         CGCGCTGGTCTCCAGTTCCCGGTGGGCCGAGTGCACCGCCTGCTCCGTAAAGGCAACTAC
NM_170745.3         AGAGCGGGTTTGCAGTTTCCCGTAGGCCGGATCCATCGTCTGCTTCGTAAGGGAAACTAT
NM_021064.4         AGGGCCGGTCTCCAGTTCCCCGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTAT
NM_003511.2         CGTGCCGGTCTCCAGTTCCCCGTGGGCCGAGTGCACCGACTGCTCCGCAAGGGCAACTAT
NM_002105.2         CGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTAC
NM_021065.3         CGGGCCGGACTCCAGTTCCCTGTGGGCCGCGTACACCGCTTGCTCCGCAAGGGCAACTAC
NM_003516.2         CGCGCTGGCCTTCAGTTCCCGGTAGGGCGAGTGCATCGCTTGCTGCGCAAAGGCAACTAC
NM_175065.2         CGCGCTGGTCTCCAGTTCCCGGTGGGGCGAGTGCACCGCTTGCTGCGCAAAGGCAACTAC
NM_003517.2         CGCGCTGGCCTCCAGTTCCCGGTAGGGCGAGTGCACCGCTTGCTGCGCAAAGGCAACTAC
NM_001040874.1      CGCGCTGGCCTTCAGTTCCCGGTAGGGCGAGTGCATCGCTTGCTGCGCAAAGGCAACTAC
NM_021052.2         AGGGCCGGTCTTCAGTTTCCAGTTGGCCGTGTGCACCGCCTCCTCCGCAAAGGCAACTAC
NM_003509.2         CGGGCCGGGCTTCAGTTTCCCGTAGGCCGAGTGCATCGCCTGCTCCGCAAAGGCAACTAT
NM_003514.2         AGAGCTGGGCTCCAATTTCCTGTAGGACGAGTGCACCGCCTGCTCCGCAAGGGCAACTAC
NM_177925.3         CGCGCGGGCCTGCAGTTCCCGGTGGGCCGAGTGCACAGACTGCTGCGCAAAGGGAACTAC
NM_021066.2         CGGGCCGGGCTTCAGTTTCCCGTAGGCCGAGTGCATCGCCTGCTCCGCAAAGGCAACTAT
NM_080596.2         CGGGCTGGGCTTCAGTTCCCCGTGGGCCGAGTGCACCGCCTGCTCCGCAAGGGTAATTAT
                    .* ** **  * **.** ** ** ** ** .* ** .*  * ** ** **.** .* ** 

HsCD00005526        GCGGAGCGAGTGGGGGCCGGCGCGCCCGTCTACATGGCTGCGGTCCTCGAGTATCTGACC
NM_003510.2         GCTGAGCGGGTCGGTGCCGGAGCGCCGGTGTACCTGGCGGCGGTGTTGGAGTACCTAACC
NM_003513.2         TCCGAGCGCGTCGGGGCTGGCGCGCCGGTGTATCTCGCGGCGGTGCTTGAGTACCTGACC
NM_033445.2         TCGGAGCGCGTGGGCGCCGGCGCCCCGGTCTATCTGGCCGCGGTGCTCGAGTACTTGACT
NM_003512.3         GCAGAGCGGGTTGGGGCAGGCGCGCCGGTGTACCTGGCGGCGGTGTTAGAGTACCTGACC
NM_170745.3         GCAGAGCGGATAGGGGCAGGCGCACCAGTGTATTTGGCGGCAGTGTTAGAGTATCTCACA
NM_021064.4         GCCGAGCGGGTCGGGGCCGGCGCGCCGGTGTATCTGGCAGCGGTGCTGGAGTACCTGACC
NM_003511.2         GCTGAGCGGGTCGGGGCCGGCGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACT
NM_002105.2         GCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACC
NM_021065.3         TCCGAGCGAGTCGGGGCCGGCGCGCCAGTGTATCTGGCGGCGGTGTTGGAGTACCTGACC
NM_003516.2         GCGGAGCGAGTGGGGGCCGGCGCGCCCGTCTACATGGCTGCGGTCCTCGAGTATCTGACC
NM_175065.2         GCGGAGCGGGTCGGGGCAGGCGCCCCGGTGTACCTGGCGGCGGTCCTCGAGTACCTGACC
NM_003517.2         GCGGAGCGGGTGGGGGCCGGCGCGCCCGTCTACATGGCGGCGGTCCTCGAGTACCTGACC
NM_001040874.1      GCGGAGCGAGTGGGGGCCGGCGCGCCCGTCTACATGGCTGCGGTCCTCGAGTATCTGACC
NM_021052.2         TCCGAACGAGTCGGGGCCGGCGCTCCAGTGTACCTGGCAGCGGTGCTGGAATATCTGACG
NM_003509.2         GCGGAGCGGGTCGGTGCTGGAGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACC
NM_003514.2         GCTGAGCGGGTCGGGGCCGGCGCGCCGGTTTACCTGGCGGCGGTGCTGGAGTACCTAACT
NM_177925.3         GCGGAGCGAGTGGGCGCCGGGGCGCCGGTGTACCTGGCGGCGGTGTTGGAGTACCTTACG
NM_021066.2         GCGGAGCGGGTCGGTGCTGGAGCGCCGGTGTACCTGGCGGCGGTGCTGGAGTACCTGACC
NM_080596.2         GCCGAGCGGGTTGGAGCCGGCGCGCCAGTGTACCTGGCTGCGGTGCTGGAGTACCTGACC
                     * **.** .* ** ** ** ** ** ** **  * ** **.**  * **.**  * ** 

HsCD00005526        GCCGAGATCCTGGAGCTGGCGGGCAACGCGGCTCGGGACAACAAGAAGACGCGCATCATC
NM_003510.2         GCCGAGATCCTGGAACTGGCTGGCAACGCGGCCCGCGACAACAAGAAGACCCGCATCATC
NM_003513.2         GCCGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACCCGCATCATC
NM_033445.2         GCCGAGATCCTGGAGCTTGCCGGCAACGCGGCGCGCGACAACAAGAAGACGCGCATCATC
NM_003512.3         GCCGAGATCCTGGAGCTGGCCGGCAACGCGGCTCGCGACAACAAGAAGACTCGCATCATC
NM_170745.3         GCAGAAATCCTTGAGCTGGCAGGCAATGCGTCTCGCGATAACAAAAAAACTCGCATTATT
NM_021064.4         GCCGAGATCCTGGAACTGGCGGGCAACGCGGCCCGCGACAACAAGAAGACCCGCATCATC
NM_003511.2         GCCGAGATCCTGGAGCTGGCGGGCAACGCCGCCCGCGACAACAAGAAGACCCGCATTATC
NM_002105.2         GCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATC
NM_021065.3         GCCGAGATCCTGGAGCTGGCGGGCAACGCCGCCCGCGACAACAAGAAGACCCGCATCATC
NM_003516.2         GCCGAGATCCTGGAGCTGGCGGGCAACGCGGCTCGGGACAACAAGAAGACGCGCATCATC
NM_175065.2         GCGGAAATTCTGGAGCTGGCGGGCAACGCGGCTCGGGACAACAAGAAGACGCGCATCATC
NM_003517.2         GCCGAGATCCTGGAGCTGGCGGGCAACGCGGCTCGGGACAACAAGAAGACGCGCATCATC
NM_001040874.1      GCCGAGATCCTGGAGCTGGCGGGCAACGCGGCTCGGGACAACAAGAAGACGCGCATCATC
NM_021052.2         GCCGAGATCTTAGAGCTAGCTGGCAACGCGGCTCGCGACAATAAGAAGACCCGCATCATC
NM_003509.2         GCCGAGATCCTGGAGCTGGCTGGCAACGCGGCCCGCGACAACAAGAAGACTCGCATCATC
NM_003514.2         GCCGAGATCCTGGAGCTGGCGGGCAACGCAGCCCGCGACAACAAAAAGACCCGCATCATC
NM_177925.3         GCGGAGATCCTGGAGCTGGCTGGCAACGCCGCGCGTGACAACAAGAAGACCAGGATAATT
NM_021066.2         GCCGAGATCCTGGAGCTGGCTGGCAACGCGGCCCGCGACAACAAGAAGACTCGCATCATC
NM_080596.2         GCTGAGATCCTGGAGCTGGCTGGCAATGCGGCCCGCGACAACAAGAAGACCCGTATCATC
                    ** **.**  * **.** ** ***** **  * ** ** ** **.**.** .* ** ** 

HsCD00005526        CCTCGTCACCTCCAGCTGGCCATCCGCAACGACGAGGAACTGAACAAGCTGCTGGGCAAA
NM_003510.2         CCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTTGGTAAA
NM_003513.2         CCGCGCCACCTGCAATTGGCCATCCGCAATGACGAGGAGCTTAATAAACTCTTGGGGCGT
NM_033445.2         CCGCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCCGC
NM_003512.3         CCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAACTGCTAGGCCGG
NM_170745.3         CCCCGCCACCTGCAGCTAGCGATCCGCAATGATGAGGAACTCAATAAGCTTTTGGGCGGC
NM_021064.4         CCGCGTCATCTCCAACTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAA
NM_003511.2         CCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAA
NM_002105.2         CCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGC
NM_021065.3         CCCCGACACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTAAACAAGTTGCTGGGTAAA
NM_003516.2         CCTCGTCACCTCCAGCTGGCCATCCGCAACGACGAGGAACTGAACAAGCTGCTGGGCAAA
NM_175065.2         CCTCGCCATCTGCAACTAGCCGTGAGGAATGACGAAGAGCTCAACAAGTTACTCGGGGGT
NM_003517.2         CCTCGTCACCTCCAGCTGGCCATCCGCAACGACGAGGAACTGAACAAGCTGCTGGGCAAA
NM_001040874.1      CCTCGTCACCTCCAGCTGGCCATCCGCAACGACGAGGAACTGAACAAGCTGCTGGGCAAA
NM_021052.2         CCGCGCCACCTGCAGCTAGCCATCCGCAACGACGAGGAGCTAAATAAGCTTCTAGGTCGC
NM_003509.2         CCGCGTCACCTCCAGCTGGCCATCCGCAACGATGAGGAGCTCAACAAGCTTCTGGGCAAA
NM_003514.2         CCGCGCCACTTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTTGGTAAA
NM_177925.3         CCCCGCCACCTGCAGCTCGCCATCCGCAACGACGAGGAGTTAAACAAGCTGCTGGGCAAA
NM_021066.2         CCGCGTCACCTCCAGCTGGCCATCCGCAACGATGAGGAGCTCAACAAGCTTCTGGGCAAA
NM_080596.2         CCGCGTCACCTCCAACTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAA
                    ** ** **  * **. * ** .* .* ** ** **.**. * ** **. *  * **  . 

HsCD00005526        GTCACCATCGCCCAGGGCGGCGTCTTGCCTAACATCCAGGCCGTACTGCTCCCTAAGAAG
NM_003510.2         GTGACCATCGCCCAGGGTGGTGTCCTGCCCAATATCCAGGCCGTGCTGCTGCCTAAGAAA
NM_003513.2         GTGACCATCGCGCAGGGTGGCGTTTTGCCTAATATTCAGGCGGTGCTGCTGCCTAAGAAA
NM_033445.2         GTGACCATCGCGCAGGGTGGCGTCCTGCCCAACATCCAGGCCGTACTGCTGCCCAAGAAG
NM_003512.3         GTGACCATTGCTCAGGGCGGCGTCCTTCCTAACATCCAGGCCGTGCTTCTGCCTAAGAAG
NM_170745.3         GTGACCATTGCCCAGGGCGGAGTCCTGCCTAACATTCAGGCAGTGCTGCTGCCCAAGAAG
NM_021064.4         GTCACCATCGCACAGGGCGGTGTCCTGCCCAACATTCAGGCCGTGCTACTGCCCAAAAAG
NM_003511.2         GTAACCATCGCTCAGGGTGGTGTCCTGCCCAACATCCAGGCTGTGCTACTGCCCAAGAAG
NM_002105.2         GTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
NM_021065.3         GTCACAATTGCTCAGGGCGGTGTTCTGCCCAACATCCAGGCTGTACTGCTCCCCAAGAAG
NM_003516.2         GTCACCATCGCCCAGGGCGGCGTCTTGCCTAACATCCAGGCCGTACTGCTCCCTAAGAAG
NM_175065.2         GTCACCATTGCCCAGGGCGGCGTCTTGCCCAATATCCAGGCTGTCCTGTTGCCCAAGAAA
NM_003517.2         GTCACCATCGCCCAGGGCGGCGTTTTGCCTAACATCCAGGCCGTTCTGTTACCAAAGAAA
NM_001040874.1      GTCACCATCGCCCAGGGCGGCGTCTTGCCTAACATCCAGGCCGTACTGCTCCCTAAGAAG
NM_021052.2         GTGACCATCGCGCAGGGCGGTGTCCTGCCCAACATCCAGGCCGTATTGCTGCCTAAGAAG
NM_003509.2         GTCACCATCGCACAGGGTGGCGTCCTGCCCAACATCCAGGCCGTGCTACTGCCCAAGAAG
NM_003514.2         GTTACCATCGCTCAGGGCGGTGTTCTGCCTAACATCCAGGCCGTACTGCTCCCCAAGAAG
NM_177925.3         GTGACCATCGCTCAGGGCGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAG
NM_021066.2         GTCACCATCGCACAGGGTGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCAAAGAAA
NM_080596.2         GTCACCATCGCGCAGGGTGGTGTCTTGCCCAATATCCAGGCCGTGCTGCTGCCTAAGAAG
                    ** ** ** ** ***** ** **  * ** ** ** ***** **  *  * ** **.**.

HsCD00005526        ACGGAGAGTCACCACAAGGCAAAGGGCAAGGAC---------------------------
NM_003510.2         ACTGAGAGCCACCACAAGGCCAAGGGCAAGTAG---------------------------
NM_003513.2         ACTGAGAGCCATCATAAGGCCAAGGGAAAGTGA---------------------------
NM_033445.2         ACGGAGAGCCACCACAAGGCCAAGGGCAAGTGA---------------------------
NM_003512.3         ACCGAGAGTCACCACAAGGCCAAGGGCAAGTGA---------------------------
NM_170745.3         ACTGAGAGTCACCACCATAAAGCCCAAAGCAAGTAA------------------------
NM_021064.4         ACTGAGAGCCACCACAAGGCGAAGGGCAAGTAA---------------------------
NM_003511.2         ACCGAGAGTCACCACAAGGCCAAAGGCAAATAA---------------------------
NM_002105.2         ACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCC
NM_021065.3         ACTGAGAGTCACCACAAGGCCAAGGGCAAGTAA---------------------------
NM_003516.2         ACGGAGAGTCACCACAAGGCAAAGGGCAAGTGA---------------------------
NM_175065.2         ACGGAGAGTCACAAGCCTGGCAAGAACAAGTAA---------------------------
NM_003517.2         ACCGAAAGCCACAAAGCCAAAAGCAAATAA------------------------------
NM_001040874.1      ACGGAGAGTCACCACAAGGCAAAGGGCAAGTGA---------------------------
NM_021052.2         ACGGAGAGCCACCATAAGGCCAAGGGCAAGTGA---------------------------
NM_003509.2         ACCGAGAGCCACCACAAGGCGAAGGGCAAGTAG---------------------------
NM_003514.2         ACTGAGAGCCACCACAAAGCTAAGGGCAAGTAA---------------------------
NM_177925.3         ACGGAGAGTCAGAAGACGAAGAGCAAATGA------------------------------
NM_021066.2         ACTGAGAGCCACCACAAGACTAAGTAA---------------------------------
NM_080596.2         ACTGAGAGCCACCATAAGGCCAAATAA---------------------------------
                    ** .. .  ..  :       .                                      

HsCD00005526        ------------
NM_003510.2         ------------
NM_003513.2         ------------
NM_033445.2         ------------
NM_003512.3         ------------
NM_170745.3         ------------
NM_021064.4         ------------
NM_003511.2         ------------
NM_002105.2         CAGGAGTACTAA
NM_021065.3         ------------
NM_003516.2         ------------
NM_175065.2         ------------
NM_003517.2         ------------
NM_001040874.1      ------------
NM_021052.2         ------------
NM_003509.2         ------------
NM_003514.2         ------------
NM_177925.3         ------------
NM_021066.2         ------------
NM_080596.2         ------------
                                

Pathways

Reactome : Amyloids
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : Chromosome Maintenance
Reactome : Condensation of Prophase Chromosomes
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : Deposition of new CENPA-containing nucleosomes at the centromere
Reactome : Disease
Reactome : Epigenetic regulation of gene expression
Reactome : Gene Expression
Reactome : HATs acetylate histones
Reactome : M Phase
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Meiotic synapsis
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Negative epigenetic regulation of rRNA expression
Reactome : NoRC negatively regulates rRNA expression
Reactome : Nucleosome assembly
Reactome : Oxidative Stress Induced Senescence
Reactome : PRC2 methylates histones and DNA
Reactome : Packaging Of Telomere Ends
Reactome : RNA Polymerase I Chain Elongation
Reactome : RNA Polymerase I Promoter Clearance
Reactome : RNA Polymerase I Promoter Opening
Reactome : RNA Polymerase I Transcription
Reactome : RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
Reactome : SIRT1 negatively regulates rRNA Expression
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by Wnt
Reactome : TCF dependent signaling in response to WNT
Reactome : Telomere Maintenance
Reactome : Transcription
Reactome : formation of the beta-catenin:TCF transactivating complex

Protein

SMART domain : H2A : Histone 2A
UniProt : Q6FI13
HPRD : 08851

Clone

Cloning Information : 130836
HIP Master Clone ID : 106993
Original Clone ID : FLH130836.01L

Organism


TAX_ID : 9606
Species Specific ID: 8337

Genome

Chromosome : 1
Map Location : 1q21.2

Reagents

Labome : HIST2H2AA4-antibody