DNASU Plasmid Repository • 480.965.5697 | Email

SOCS3 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOCS3
Gene Name:  suppressor of cytokine signaling 3
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131028.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00005549

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 678nts         Open reading frame : 1 to 678
Reference Sequence Alignment

ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTG
CGCCTCAAGACCTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAG
CTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTC
AGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTC
ACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGC
AGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTG
CTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCT
ACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCC
CCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGG
CCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGTCAACGGCCAC
CTGGACTCCTATGAGAAAGTCACCCAGCTGCCGGGGCCCATTCGGGAGTTCCTGGACCAG
TACGATGCCCCGCTTGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1094
Start on reference sequence 417
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOCS3
Symbol Nomenclature : SOCS3
SYNONYM : ATOD4; CIS3; Cish3; SOCS-3; SSI-3; SSI3
Designation : STAT-induced STAT inhibitor 3|cytokine-inducible SH2 protein 3
Full Nomenclature : suppressor of cytokine signaling 3
GENEID : 9021
GI : 60834708
GenBank Accession : AY894070
HGNC : 19391
MIM : 604176
Vega : OTTHUMG00000177513
Target GenBank: BC060858

 

Reference Sequence Alignment

  

HsCD00005549      ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTG
NM_003955.4       ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTG
                  ************************************************************

HsCD00005549      CGCCTCAAGACCTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAG
NM_003955.4       CGCCTCAAGACCTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAG
                  ************************************************************

HsCD00005549      CTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTC
NM_003955.4       CTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTC
                  ************************************************************

HsCD00005549      AGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTC
NM_003955.4       AGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTC
                  ************************************************************

HsCD00005549      ACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGC
NM_003955.4       ACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGC
                  ************************************************************

HsCD00005549      AGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTG
NM_003955.4       AGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTG
                  ************************************************************

HsCD00005549      CTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCT
NM_003955.4       CTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCT
                  ************************************************************

HsCD00005549      ACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCC
NM_003955.4       ACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCC
                  ************************************************************

HsCD00005549      CCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGG
NM_003955.4       CCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGG
                  ************************************************************

HsCD00005549      CCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGTCAACGGCCAC
NM_003955.4       CCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGTCAACGGCCAC
                  ************************************************************

HsCD00005549      CTGGACTCCTATGAGAAAGTCACCCAGCTGCCGGGGCCCATTCGGGAGTTCCTGGACCAG
NM_003955.4       CTGGACTCCTATGAGAAAGTCACCCAGCTGCCGGGGCCCATTCGGGAGTTCCTGGACCAG
                  ************************************************************

HsCD00005549      TACGATGCCCCGCTTGAC
NM_003955.4       TACGATGCCCCGCTTTAA
                  *************** *.

Pathways

NCI : ATF-2 transcription factor network
NCI : EPO signaling pathway
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Signaling events mediated by PTP1B
Panther : Interferon-gamma signaling pathway
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interleukin-6 signaling
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
WikiPathway : Adipogenesis
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Type II interferon signaling (IFNG)

Protein

SMART domain : SOCS : suppressors of cytokine signalling
SMART domain : SH2 : Src homology 2 domains
SMART domain : SOCS_box :
UniProt : Q6FI39
UniProt : O14543
HPRD : 05006

Clone

Cloning Information : 131028
HIP Master Clone ID : 107185
Original Clone ID : FLH131028.01L

Organism


TAX_ID : 9606
Species Specific ID: 9021

Genome

Chromosome : 17
Map Location : 17q25.3
Ensembl : ENSG00000184557

Reagents

Labome : SOCS3-antibody