DNASU Plasmid Repository • 480.965.5697 | Email

ELK1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ELK1
Gene Name:  ELK1, member of ETS oncogene family
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH131099.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00005561

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1287nts         Open reading frame : 1 to 1287
Reference Sequence Alignment

ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAAT
GGCCACATCATCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAG
GAGGTGGCCCGGCTGTGGGGGCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTC
AGCCGGGCCTTGCGGTACTACTATGACAAGAACATCATCCGCAAGGTGAGCGGCCAGAAG
TTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGTGCTCCACTGAGGACTGCCCG
CCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGCTGCTATACAT
GCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA
GGCCCAGGCGGTGTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCC
ACCTTCACCATCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTG
CTCCCCAGTGCAGCTCCTGCAGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGT
CCAAGCCCCTTGGAGGCCTGTCTGGAGGCTGAAGAGGCCGGCTTGCCTCTGCAGGTCATC
CTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGCTTAATGTGGAGCCGGGTTTG
GGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTTGGAAGTTGCG
GGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG
GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCAT
GCGGCTTCCAGCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAG
CTTCCACTCAGCCCGAGCCTGCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGA
AGTGGCTCCGGCCTCCAGGCTCCGGGGCCGGCGCTGACCCCATCCCTGCTTCCTACGCAT
ACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTCCTAGCATTCACTTCTGGAGC
ACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTTTCCATCCAGT
GGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG
CTCTCCCCAGGGCCCCAGAAGCCATGA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1333
Start on reference sequence 47
Mutations:
None
Discrepancy:
t433g,L145V
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ELK1
Symbol Nomenclature : ELK1
Designation : ETS domain-containing protein Elk-1|ETS-like gene 1|tyrosine kinase (ELK1) oncogene
Full Nomenclature : ELK1, member of ETS oncogene family
GENEID : 2002
GI : 60823626
GenBank Accession : AY893613
HGNC : 3321
MIM : 311040
Vega : OTTHUMG00000021452
Target GenBank: BC056150

 

Reference Sequence Alignment

  

HsCD00005561        ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAAT
NM_001114123.2      ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAAT
NM_005229.4         ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAAT
                    ************************************************************

HsCD00005561        GGCCACATCATCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAG
NM_001114123.2      GGCCACATCATCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAG
NM_005229.4         GGCCACATCATCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAG
                    ************************************************************

HsCD00005561        GAGGTGGCCCGGCTGTGGGGGCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTC
NM_001114123.2      GAGGTGGCCCGGCTGTGGGGGCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTC
NM_005229.4         GAGGTGGCCCGGCTGTGGGGGCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTC
                    ************************************************************

HsCD00005561        AGCCGGGCCTTGCGGTACTACTATGACAAGAACATCATCCGCAAGGTGAGCGGCCAGAAG
NM_001114123.2      AGCCGGGCCTTGCGGTACTACTATGACAAGAACATCATCCGCAAGGTGAGCGGCCAGAAG
NM_005229.4         AGCCGGGCCTTGCGGTACTACTATGACAAGAACATCATCCGCAAGGTGAGCGGCCAGAAG
                    ************************************************************

HsCD00005561        TTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGTGCTCCACTGAGGACTGCCCG
NM_001114123.2      TTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGTGCTCCACTGAGGACTGCCCG
NM_005229.4         TTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGTGCTCCACTGAGGACTGCCCG
                    ************************************************************

HsCD00005561        CCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGCTGCTATACAT
NM_001114123.2      CCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGCTGCTATACAT
NM_005229.4         CCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGCTGCTATACAT
                    ************************************************************

HsCD00005561        GCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA
NM_001114123.2      GCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA
NM_005229.4         GCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA
                    ************************************************************

HsCD00005561        GGCCCAGGCGGTGTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCC
NM_001114123.2      GGCCCAGGCGGTTTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCC
NM_005229.4         GGCCCAGGCGGTTTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCC
                    ************ ***********************************************

HsCD00005561        ACCTTCACCATCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTG
NM_001114123.2      ACCTTCACCATCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTG
NM_005229.4         ACCTTCACCATCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTG
                    ************************************************************

HsCD00005561        CTCCCCAGTGCAGCTCCTGCAGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGT
NM_001114123.2      CTCCCCAGTGCAGCTCCTGCAGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGT
NM_005229.4         CTCCCCAGTGCAGCTCCTGCAGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGT
                    ************************************************************

HsCD00005561        CCAAGCCCCTTGGAGGCCTGTCTGGAGGCTGAAGAGGCCGGCTTGCCTCTGCAGGTCATC
NM_001114123.2      CCAAGCCCCTTGGAGGCCTGTCTGGAGGCTGAAGAGGCCGGCTTGCCTCTGCAGGTCATC
NM_005229.4         CCAAGCCCCTTGGAGGCCTGTCTGGAGGCTGAAGAGGCCGGCTTGCCTCTGCAGGTCATC
                    ************************************************************

HsCD00005561        CTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGCTTAATGTGGAGCCGGGTTTG
NM_001114123.2      CTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGCTTAATGTGGAGCCGGGTTTG
NM_005229.4         CTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGCTTAATGTGGAGCCGGGTTTG
                    ************************************************************

HsCD00005561        GGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTTGGAAGTTGCG
NM_001114123.2      GGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTTGGAAGTTGCG
NM_005229.4         GGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTTGGAAGTTGCG
                    ************************************************************

HsCD00005561        GGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG
NM_001114123.2      GGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG
NM_005229.4         GGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG
                    ************************************************************

HsCD00005561        GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCAT
NM_001114123.2      GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCAT
NM_005229.4         GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCAT
                    ************************************************************

HsCD00005561        GCGGCTTCCAGCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAG
NM_001114123.2      GCGGCTTCCAGCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAG
NM_005229.4         GCGGCTTCCAGCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAG
                    ************************************************************

HsCD00005561        CTTCCACTCAGCCCGAGCCTGCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGA
NM_001114123.2      CTTCCACTCAGCCCGAGCCTGCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGA
NM_005229.4         CTTCCACTCAGCCCGAGCCTGCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGA
                    ************************************************************

HsCD00005561        AGTGGCTCCGGCCTCCAGGCTCCGGGGCCGGCGCTGACCCCATCCCTGCTTCCTACGCAT
NM_001114123.2      AGTGGCTCCGGCCTCCAGGCTCCGGGGCCGGCGCTGACCCCATCCCTGCTTCCTACGCAT
NM_005229.4         AGTGGCTCCGGCCTCCAGGCTCCGGGGCCGGCGCTGACCCCATCCCTGCTTCCTACGCAT
                    ************************************************************

HsCD00005561        ACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTCCTAGCATTCACTTCTGGAGC
NM_001114123.2      ACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTCCTAGCATTCACTTCTGGAGC
NM_005229.4         ACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTCCTAGCATTCACTTCTGGAGC
                    ************************************************************

HsCD00005561        ACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTTTCCATCCAGT
NM_001114123.2      ACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTTTCCATCCAGT
NM_005229.4         ACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTTTCCATCCAGT
                    ************************************************************

HsCD00005561        GGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG
NM_001114123.2      GGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG
NM_005229.4         GGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG
                    ************************************************************

HsCD00005561        CTCTCCCCAGGGCCCCAGAAGCCATGA
NM_001114123.2      CTCTCCCCAGGGCCCCAGAAGCCATGA
NM_005229.4         CTCTCCCCAGGGCCCCAGAAGCCATGA
                    ***************************

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : BCR signaling pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : ErbB1 downstream signaling
NCI : HIF-2-alpha transcription factor network
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : S1P2 pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Interleukin signaling pathway
Panther : Oxidative stress response
Panther : PDGF signaling pathway
Panther : Parkinson disease
Panther : Ras Pathway
Panther : Toll receptor signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : ERK/MAPK targets
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : ErbB signaling pathway
WikiPathway : Estrogen signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : ID signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : SRF and miRs in Smooth Muscle Differentiation and Proliferation
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Serotonin Receptor 4/6/7 and NR3C Signaling
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway

Protein

SMART domain : ETS : erythroblast transformation specific domain
UniProt : P19419
HPRD : 02407

Clone

Cloning Information : 131099
HIP Master Clone ID : 107256
Original Clone ID : FLH131099.01X

Organism


TAX_ID : 9606
Species Specific ID: 2002

Genome

Chromosome : X
Map Location : Xp11.2
Ensembl : ENSG00000126767

Reagents

Labome : Elk-1-antibody