DNASU Plasmid Repository • 480.965.5697 | Email

TRAF2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TRAF2
Gene Name:  TNF receptor-associated factor 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH119614.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00005676

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1506nts         Open reading frame : 1 to 1506
Reference Sequence Alignment

ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTCTCC
AAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAGAAACGTC
CTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTGCCTGGCCAGC
ATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAA
GGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGGGAGGTG
GAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGAAGGGGACCCTGAAAGAA
TACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAA
GGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGC
CTGAGCTGCCGGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAG
GTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAG
AAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCC
ATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTG
CGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGAC
CAGAGCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCC
ACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC
GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAG
GTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAG
AAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGAC
TTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCC
TTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGC
ACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCC
CTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGG
GAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTC
AACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCA
AAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATTGTGGACCTGACAGGG
CTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1549
Start on reference sequence 44
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TRAF2
Symbol Nomenclature : TRAF2
SYNONYM : MGC:45012; TRAP; TRAP3
Designation : E3 ubiquitin-protein ligase TRAF2|tumor necrosis factor type 2 receptor associated protein 3|tumor necrosis factor type 2 receptor-associated protein 3
Full Nomenclature : TNF receptor-associated factor 2
GENEID : 7186
GI : 61364125
GenBank Accession : AY890552
HGNC : 12032
MIM : 601895
Vega : OTTHUMG00000020952
Target GenBank: BC032410

 

Reference Sequence Alignment

  

HsCD00005676      ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTCTCC
NM_021138.3       ATGGCTGCAGCTAGCGTGACCCCCCCTGGCTCCCTGGAGTTGCTACAGCCCGGCTTCTCC
                  ************************************************************

HsCD00005676      AAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAGAAACGTC
NM_021138.3       AAGACCCTCCTGGGGACCAAGCTGGAAGCCAAGTACCTGTGCTCCGCCTGCAGAAACGTC
                  ************************************************************

HsCD00005676      CTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTGCCTGGCCAGC
NM_021138.3       CTCCGCAGGCCCTTCCAGGCGCAGTGTGGCCACCGGTACTGCTCCTTCTGCCTGGCCAGC
                  ************************************************************

HsCD00005676      ATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAA
NM_021138.3       ATCCTCAGCTCTGGGCCTCAGAACTGTGCTGCCTGTGTTCACGAGGGCATATATGAAGAA
                  ************************************************************

HsCD00005676      GGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGGGAGGTG
NM_021138.3       GGCATTTCTATTTTAGAAAGCAGTTCGGCCTTCCCAGATAATGCTGCCCGCAGGGAGGTG
                  ************************************************************

HsCD00005676      GAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGAAGGGGACCCTGAAAGAA
NM_021138.3       GAGAGCCTGCCGGCCGTCTGTCCCAGTGATGGATGCACCTGGAAGGGGACCCTGAAAGAA
                  ************************************************************

HsCD00005676      TACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAA
NM_021138.3       TACGAGAGCTGCCACGAAGGCCGCTGCCCGCTCATGCTGACCGAATGTCCCGCGTGCAAA
                  ************************************************************

HsCD00005676      GGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGC
NM_021138.3       GGCCTGGTCCGCCTTGGTGAAAAGGAGCGCCACCTGGAGCACGAGTGCCCGGAGAGAAGC
                  ************************************************************

HsCD00005676      CTGAGCTGCCGGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAG
NM_021138.3       CTGAGCTGCCGGCATTGCCGGGCACCCTGCTGCGGAGCAGACGTGAAGGCGCACCACGAG
                  ************************************************************

HsCD00005676      GTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAG
NM_021138.3       GTCTGCCCCAAGTTCCCCTTAACTTGTGACGGCTGCGGCAAGAAGAAGATCCCCCGGGAG
                  ************************************************************

HsCD00005676      AAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCC
NM_021138.3       AAGTTTCAGGACCACGTCAAGACTTGTGGCAAGTGTCGAGTCCCTTGCAGATTCCACGCC
                  ************************************************************

HsCD00005676      ATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTG
NM_021138.3       ATCGGCTGCCTCGAGACGGTAGAGGGTGAGAAACAGCAGGAGCACGAGGTGCAGTGGCTG
                  ************************************************************

HsCD00005676      CGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGAC
NM_021138.3       CGGGAGCACCTGGCCATGCTACTGAGCTCGGTGCTGGAGGCAAAGCCCCTCTTGGGAGAC
                  ************************************************************

HsCD00005676      CAGAGCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCC
NM_021138.3       CAGAGCCACGCGGGGTCAGAGCTCCTGCAGAGGTGCGAGAGCCTGGAGAAGAAGACGGCC
                  ************************************************************

HsCD00005676      ACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC
NM_021138.3       ACTTTTGAGAACATTGTCTGCGTCCTGAACCGGGAGGTGGAGAGGGTGGCCATGACTGCC
                  ************************************************************

HsCD00005676      GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAG
NM_021138.3       GAGGCCTGCAGCCGGCAGCACCGGCTGGACCAAGACAAGATTGAAGCCCTGAGTAGCAAG
                  ************************************************************

HsCD00005676      GTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAG
NM_021138.3       GTGCAGCAGCTGGAGAGGAGCATTGGCCTCAAGGACCTGGCGATGGCTGACTTGGAGCAG
                  ************************************************************

HsCD00005676      AAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGAC
NM_021138.3       AAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGAC
                  ************************************************************

HsCD00005676      TTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCC
NM_021138.3       TTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCC
                  ************************************************************

HsCD00005676      TTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGC
NM_021138.3       TTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGC
                  ************************************************************

HsCD00005676      ACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCC
NM_021138.3       ACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCC
                  ************************************************************

HsCD00005676      CTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGG
NM_021138.3       CTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGG
                  ************************************************************

HsCD00005676      GAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTC
NM_021138.3       GAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTC
                  ************************************************************

HsCD00005676      AACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCA
NM_021138.3       AACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCA
                  ************************************************************

HsCD00005676      AAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATTGTGGACCTGACAGGG
NM_021138.3       AAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATTGTGGACCTGACAGGG
                  ************************************************************

HsCD00005676      CTCTAG
NM_021138.3       CTCTAA
                  *****.

Pathways

NCI : CD40/CD40L signaling
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
NCI : p38 MAPK signaling pathway
Panther : Apoptosis signaling pathway
Panther : p53 pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation by c-FLIP
Reactome : TNF signaling
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRAF6 mediated NF-kB activation
WikiPathway : Apoptosis
WikiPathway : MAPK signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : p38 MAPK Signaling Pathway

Protein

SMART domain : MATH : meprin and TRAF homology
SMART domain : RING : Ring finger
UniProt : Q12933
HPRD : 03538

Clone

Cloning Information : 119614
HIP Master Clone ID : 95268
Original Clone ID : FLH119614.01X

Organism


TAX_ID : 9606
Species Specific ID: 7186

Genome

Chromosome : 9
Map Location : 9q34
Ensembl : ENSG00000127191

Reagents

Labome : TRAF2-antibody