DNASU Plasmid Repository • 480.965.5697 | Email

EEF2K (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EEF2K
Gene Name:  eukaryotic elongation factor-2 kinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH159313.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00005708

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2178nts         Open reading frame : 1 to 2178
Reference Sequence Alignment

ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
GCTGGCCGTGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
TGGAAGGGAGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
GCCCAGATGGAGGAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2374
Start on reference sequence 197
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EEF2K
Symbol Nomenclature : EEF2K
SYNONYM : HSU93850; eEF-2K
Designation : calcium/calmodulin-dependent eukaryotic elongation factor 2 kinase|calcium/calmodulin-dependent eukaryotic elongation factor-2 kinase|calmodulin-dependent protein kinase III|eEF-2 kinase|elongation factor-2 kinase|eukaroytic elongation factor 2 kinase|eukaryotic elongation factor 2 kinase
Full Nomenclature : eukaryotic elongation factor-2 kinase
GENEID : 29904
GI : 61354537
GenBank Accession : AY888070
HGNC : 24615
MIM : 606968
Target GenBank: BC032665

 

Reference Sequence Alignment

  

HsCD00005708        ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
NM_013302.3         ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
XM_005276497.1      ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
                    ************************************************************

HsCD00005708        GCTGGCCGTGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
NM_013302.3         GCTGGCCATGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
XM_005276497.1      GCTGGCCATGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
                    *******.****************************************************

HsCD00005708        CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
NM_013302.3         CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
XM_005276497.1      CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
                    ************************************************************

HsCD00005708        AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
NM_013302.3         AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
XM_005276497.1      AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
                    ************************************************************

HsCD00005708        TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
NM_013302.3         TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
XM_005276497.1      TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
                    ************************************************************

HsCD00005708        GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
NM_013302.3         GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
XM_005276497.1      GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
                    ************************************************************

HsCD00005708        ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
NM_013302.3         ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
XM_005276497.1      ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
                    ************************************************************

HsCD00005708        GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
NM_013302.3         GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
XM_005276497.1      GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
                    ************************************************************

HsCD00005708        TGGAAGGGAGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
NM_013302.3         TGGAAGGGCGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
XM_005276497.1      TGGAAGGGCGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
                    ********.***************************************************

HsCD00005708        TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
NM_013302.3         TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
XM_005276497.1      TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
                    ************************************************************

HsCD00005708        CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
NM_013302.3         CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
XM_005276497.1      CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
                    ************************************************************

HsCD00005708        CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
NM_013302.3         CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
XM_005276497.1      CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
                    ************************************************************

HsCD00005708        TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
NM_013302.3         TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
XM_005276497.1      TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
                    ************************************************************

HsCD00005708        TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
NM_013302.3         TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
XM_005276497.1      TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
                    ************************************************************

HsCD00005708        CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
NM_013302.3         CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
XM_005276497.1      CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
                    ************************************************************

HsCD00005708        GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
NM_013302.3         GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
XM_005276497.1      GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
                    ************************************************************

HsCD00005708        ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
NM_013302.3         ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
XM_005276497.1      ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
                    ************************************************************

HsCD00005708        AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
NM_013302.3         AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
XM_005276497.1      AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
                    ************************************************************

HsCD00005708        CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
NM_013302.3         CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
XM_005276497.1      CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
                    ************************************************************

HsCD00005708        GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
NM_013302.3         GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
XM_005276497.1      GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
                    ************************************************************

HsCD00005708        ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
NM_013302.3         ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
XM_005276497.1      ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
                    ************************************************************

HsCD00005708        ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
NM_013302.3         ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
XM_005276497.1      ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
                    ************************************************************

HsCD00005708        AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
NM_013302.3         AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
XM_005276497.1      AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
                    ************************************************************

HsCD00005708        CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
NM_013302.3         CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
XM_005276497.1      CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
                    ************************************************************

HsCD00005708        GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
NM_013302.3         GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
XM_005276497.1      GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
                    ************************************************************

HsCD00005708        GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
NM_013302.3         GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
XM_005276497.1      GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
                    ************************************************************

HsCD00005708        TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
NM_013302.3         TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
XM_005276497.1      TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
                    ************************************************************

HsCD00005708        GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
NM_013302.3         GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
XM_005276497.1      GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
                    ************************************************************

HsCD00005708        CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
NM_013302.3         CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
XM_005276497.1      CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
                    ************************************************************

HsCD00005708        ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
NM_013302.3         ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
XM_005276497.1      ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
                    ************************************************************

HsCD00005708        TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
NM_013302.3         TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
XM_005276497.1      TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
                    ************************************************************

HsCD00005708        GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
NM_013302.3         GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
XM_005276497.1      GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
                    ************************************************************

HsCD00005708        TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
NM_013302.3         TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
XM_005276497.1      TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
                    ************************************************************

HsCD00005708        GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
NM_013302.3         GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
XM_005276497.1      GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
                    ************************************************************

HsCD00005708        GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
NM_013302.3         GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
XM_005276497.1      GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
                    ************************************************************

HsCD00005708        ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
NM_013302.3         ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
XM_005276497.1      ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
                    ************************************************************

HsCD00005708        GCCCAGATGGAGGAGTTG
NM_013302.3         GCCCAGATGGAGGAGTAA
XM_005276497.1      GCCCAGATGGAGGAGTAA
                    ****************:.

Pathways

NCI : Signaling mediated by p38-gamma and p38-delta
NCI : mTOR signaling pathway
Panther : Oxidative stress response
Panther : p38 MAPK pathway
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Insulin receptor signalling cascade
Reactome : PI3K Cascade
Reactome : PKB-mediated events
Reactome : S6K1 signalling
Reactome : S6K1-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : mTOR signalling
Reactome : mTORC1-mediated signalling
WikiPathway : AMPK signaling
WikiPathway : Translation Factors

Protein

SMART domain : Alpha_kinase : Alpha-kinase family
UniProt : O00418
HPRD : 07369

Clone

Cloning Information : 159313
HIP Master Clone ID : 134848
Original Clone ID : FLH159313.01L

Organism


TAX_ID : 9606
Species Specific ID: 29904

Genome

Chromosome : 16
Map Location : 16p12.2