DNASU Plasmid Repository • 480.965.5697 | Email

CCNE1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CCNE1
Gene Name:  cyclin E1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH139782.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00005754

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1233nts         Open reading frame : 1 to 1233
Reference Sequence Alignment

ATGCCGAGGGAGCGCAGGGAGCGGGATGCGAAGGAGCGGGACACCATGAAGGAGGACGGC
GGCGCGGAGTTCTCGGCTCGCTCCAGGAAGAGGAAGGCAAACGTGACCGTTTTTTTGCAG
GATCCAGATGAAGAAATGGCCAAAATCGACAGGACGGCGAGGGACCAGTGTGGGAGCCAG
CCTTGGGACAATAATGCAGTCTGTGCAGACCCCTGCTCCCTGATCCCCACACCTGACAAA
GAAGATGATGACCGGGTTTACCCAAACTCAACGTGCAAGCCTCGGATTATTGCACCATCC
AGAGGCTCCCCGCTGCCTGTACTGAGCTGGGCAAATAGAGAGGAAGTCTGGAAAATCATG
TTAAACAAGGAAAAGACATACTTAAGGGATCAGCACTTTCTTGAGCAACACCCTCTTCTG
CAGCCAAAAATGCGAGCAATTCTTCTGGATTGGTTAATGGAGGTGTGTGAAGTCTATAAA
CTTCACAGGGAGACCTTTTACTTGGCACAAGATTTCTTTGACCGGTATATGGCGACACAA
GAAAATGTTGTAAAAACTCTTTTACAGCTTATTGGGATTTCATCTTTATTTATTGCAGCC
AAACTTGAGGAAATCTATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCT
TGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGT
TTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAAT
GACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAG
CTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCT
GCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAG
TGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAG
ACGGGGAGCTCAAAACTGAAGCACTTCAGGGGCGTCGCTGATGAAGATGCACACAACATA
CAGACCCACAGAGACAGCTTGGATTTGCTGGACAAAGCCCGAGCAAAGAAAGCCATGTTG
TCTGAACAAAATAGGGCTTCTCCTCTCCCCAGTGGGCTCCTCACCCCGCCACAGAGCGGT
AAGAAGCAGAGCAGCGGGCCGGAAATGGCGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1406
Start on reference sequence 174
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CCNE1
Symbol Nomenclature : CCNE1
SYNONYM : CCNE
Designation : G1/S-specific cyclin-E1|cyclin E variant ex5del|cyclin E variant ex7del|cyclin Es|cyclin Et
Full Nomenclature : cyclin E1
GENEID : 898
GI : 61364338
GenBank Accession : AY890585
HGNC : 1589
MIM : 123837
Vega : OTTHUMG00000177626
Target GenBank: BC035498

 

Reference Sequence Alignment

  

HsCD00005754      ATGCCGAGGGAGCGCAGGGAGCGGGATGCGAAGGAGCGGGACACCATGAAGGAGGACGGC
NM_001238.2       ATGCCGAGGGAGCGCAGGGAGCGGGATGCGAAGGAGCGGGACACCATGAAGGAGGACGGC
                  ************************************************************

HsCD00005754      GGCGCGGAGTTCTCGGCTCGCTCCAGGAAGAGGAAGGCAAACGTGACCGTTTTTTTGCAG
NM_001238.2       GGCGCGGAGTTCTCGGCTCGCTCCAGGAAGAGGAAGGCAAACGTGACCGTTTTTTTGCAG
                  ************************************************************

HsCD00005754      GATCCAGATGAAGAAATGGCCAAAATCGACAGGACGGCGAGGGACCAGTGTGGGAGCCAG
NM_001238.2       GATCCAGATGAAGAAATGGCCAAAATCGACAGGACGGCGAGGGACCAGTGTGGGAGCCAG
                  ************************************************************

HsCD00005754      CCTTGGGACAATAATGCAGTCTGTGCAGACCCCTGCTCCCTGATCCCCACACCTGACAAA
NM_001238.2       CCTTGGGACAATAATGCAGTCTGTGCAGACCCCTGCTCCCTGATCCCCACACCTGACAAA
                  ************************************************************

HsCD00005754      GAAGATGATGACCGGGTTTACCCAAACTCAACGTGCAAGCCTCGGATTATTGCACCATCC
NM_001238.2       GAAGATGATGACCGGGTTTACCCAAACTCAACGTGCAAGCCTCGGATTATTGCACCATCC
                  ************************************************************

HsCD00005754      AGAGGCTCCCCGCTGCCTGTACTGAGCTGGGCAAATAGAGAGGAAGTCTGGAAAATCATG
NM_001238.2       AGAGGCTCCCCGCTGCCTGTACTGAGCTGGGCAAATAGAGAGGAAGTCTGGAAAATCATG
                  ************************************************************

HsCD00005754      TTAAACAAGGAAAAGACATACTTAAGGGATCAGCACTTTCTTGAGCAACACCCTCTTCTG
NM_001238.2       TTAAACAAGGAAAAGACATACTTAAGGGATCAGCACTTTCTTGAGCAACACCCTCTTCTG
                  ************************************************************

HsCD00005754      CAGCCAAAAATGCGAGCAATTCTTCTGGATTGGTTAATGGAGGTGTGTGAAGTCTATAAA
NM_001238.2       CAGCCAAAAATGCGAGCAATTCTTCTGGATTGGTTAATGGAGGTGTGTGAAGTCTATAAA
                  ************************************************************

HsCD00005754      CTTCACAGGGAGACCTTTTACTTGGCACAAGATTTCTTTGACCGGTATATGGCGACACAA
NM_001238.2       CTTCACAGGGAGACCTTTTACTTGGCACAAGATTTCTTTGACCGGTATATGGCGACACAA
                  ************************************************************

HsCD00005754      GAAAATGTTGTAAAAACTCTTTTACAGCTTATTGGGATTTCATCTTTATTTATTGCAGCC
NM_001238.2       GAAAATGTTGTAAAAACTCTTTTACAGCTTATTGGGATTTCATCTTTATTTATTGCAGCC
                  ************************************************************

HsCD00005754      AAACTTGAGGAAATCTATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCT
NM_001238.2       AAACTTGAGGAAATCTATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCT
                  ************************************************************

HsCD00005754      TGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGT
NM_001238.2       TGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGT
                  ************************************************************

HsCD00005754      TTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAAT
NM_001238.2       TTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAAT
                  ************************************************************

HsCD00005754      GACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAG
NM_001238.2       GACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAG
                  ************************************************************

HsCD00005754      CTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCT
NM_001238.2       CTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCT
                  ************************************************************

HsCD00005754      GCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAG
NM_001238.2       GCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAG
                  ************************************************************

HsCD00005754      TGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAG
NM_001238.2       TGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAG
                  ************************************************************

HsCD00005754      ACGGGGAGCTCAAAACTGAAGCACTTCAGGGGCGTCGCTGATGAAGATGCACACAACATA
NM_001238.2       ACGGGGAGCTCAAAACTGAAGCACTTCAGGGGCGTCGCTGATGAAGATGCACACAACATA
                  ************************************************************

HsCD00005754      CAGACCCACAGAGACAGCTTGGATTTGCTGGACAAAGCCCGAGCAAAGAAAGCCATGTTG
NM_001238.2       CAGACCCACAGAGACAGCTTGGATTTGCTGGACAAAGCCCGAGCAAAGAAAGCCATGTTG
                  ************************************************************

HsCD00005754      TCTGAACAAAATAGGGCTTCTCCTCTCCCCAGTGGGCTCCTCACCCCGCCACAGAGCGGT
NM_001238.2       TCTGAACAAAATAGGGCTTCTCCTCTCCCCAGTGGGCTCCTCACCCCGCCACAGAGCGGT
                  ************************************************************

HsCD00005754      AAGAAGCAGAGCAGCGGGCCGGAAATGGCGTAG
NM_001238.2       AAGAAGCAGAGCAGCGGGCCGGAAATGGCGTGA
                  *******************************..

Pathways

NCI : BARD1 signaling events
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : PLK3 signaling events
NCI : Regulation of retinoblastoma protein
NCI : Signaling events mediated by PRL
NCI : mTOR signaling pathway
Panther : Cell cycle
Panther : Parkinson disease
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cyclin A:Cdk2-associated events at S phase entry
Reactome : Cyclin E associated events during G1/S transition
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : E2F mediated regulation of DNA replication
Reactome : G0 and Early G1
Reactome : G1/S DNA Damage Checkpoints
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : Mitotic G1-G1/S phases
Reactome : Phosphorylation of proteins involved in G1/S transition by active Cyclin E:Cdk2 complexes
Reactome : S Phase
Reactome : SCF(Skp2)-mediated degradation of p27/p21
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : ID signaling pathway
WikiPathway : TSH signaling pathway
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Clone

Cloning Information : 139782
HIP Master Clone ID : 116049
Original Clone ID : FLH139782.01X

Organism


TAX_ID : 9606
Species Specific ID: 898

Genome

Chromosome : 19
Map Location : 19q12
Ensembl : ENSG00000105173

Reagents

Labome : cyclin-E-antibody