DNASU Plasmid Repository • 480.965.5697 | Email

PCK1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PCK1
Gene Name:  phosphoenolpyruvate carboxykinase 1 (soluble)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH159241.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00005778

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1869nts         Open reading frame : 1 to 1869
Reference Sequence Alignment

ATGCCTCCTCAGCTGCAAAACGGCCTGAACCTCTCGGCCAAAGTTGTCCAGGGAAGCCTG
GACAGCCTGCCCCAGGCAGTGAGGGAGTTTCTCGAGAATAACGCTGAGCTGTGTCAGCCT
GATCACATCCACATCTGTGACGGCTCTGAGGAGGAGAATGGGCGGCTTCTGGGCCAGATG
GAGGAAGAGGGCATCCTCAGGCGGCTGAAGAAGTATGACAACTGCTGGTTGGCTCTCACT
GACCCCAGGGATGTGGCCAGGATCGAAAGCAAGACGGTTATCGTCACCCAAGAGCAAAGA
GACACAGTGCCCATCCCCAAAACAGGCCTCAGCCAGCTCGGTCGCTGGATGTCAGAGGAG
GATTTTGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTAC
GTCATCCCATTCAGCATGGGGCCGCTGGGCTCACCTCTGTCGAAGATCGGCATCGAGCTG
ACGGATTCGCCCTACGTGGTGGCCAGCATGCGGATCATGACGCGGATGGGCACGCCCGTC
CTGGAAGCACTGGGCGATGGGGAGTTTGTCAAATGCCTCCATTCTGTGGGGTGCCCTCTG
CCTTTACAAAAGCCTTTGGTCAACAACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCC
CACCTGCCTGACCGCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTG
CTCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGGAGGAAGGGTGG
CTGGCAGAGCACATGCTGGTTCTGGGTATAACCAACCCTGAGGGTGAGAAGAAGTACCTG
GCGGCCGCATTTCCCAGCGCCTGCGGGAAGACCAACCTGGCCATGATGAACCCCAGCCTC
CCCGGGTGGAAGGTTGAGTGCGTCGGGGATGACATTGCCTGGATGAAGTTTGACGCACAA
GGTCATTTAAGGGCCATCAACCCAGAAAATGGCTTTTTCGGTGTCGCTCCTGGGACTTCA
GTGAAGACCAACCCCAATGCCATCAAGACCATCCAGAAGAACACAATCTTTACCAATGTG
GCCGAGACCAGCGACGGGGGCGTTTACTGGGAAGGCATTGATGAGCCGCTAGCTTCAGGT
GTCACCATCACGTCCTGGAAGAATAAGGAGTGGAGCTCAGAGGATGGGGAACCTTGTGCC
CACCCCAACTCGAGGTTCTGCACCCCTGCCAGCCAGTGCCCCATCATTGATGCTGCCTGG
GAGTCTCCGGAAGGTGTTCCCATTGAAGGCATTATCTTTGGAGGCCGTAGACCTGCTGGT
GTCCCTCTAGTCTATGAAGCTCTCAGCTGGCAACATGGAGTCTTTGTGGGGGCGGCCATG
AGATCAGAGGCCACAGCGGCTGCAGAACATAAAGGCAAAATCATCATGCATGACCCCTTT
GCCATGCGGCCCTTCTTTGGCTACAACTTCGGCAAATACCTGGCCCACTGGCTTAGCATG
GCCCAGCACCCAGCAGCCAAACTGCCCAAGATCTTCCATGTCAACTGGTTCCGGAAGGAC
AAGGAAGGCAAATTCCTCTGGCCAGGCTTTGGAGAGAACTCCAGGGTGCTGGAGTGGATG
TTCAACCGGATCGATGGAAAAGCCAGCACCAAGCTCACGCCCATAGGCTACATCCCCAAG
GAGGATGCCCTGAACCTGAAAGGCCTGGGGCACATCAACATGATGGAGCTTTTCAGCATC
TCCAAGGAATTCTGGGAGAAGGAGGTGGAAGACATCGAGAAGTATCTGGAGGATCAAGTC
AATGCCGACCTCCCCTGTGAAATCGAGAGAGAGATCCTTGCCTTGAAGCAAAGAATAAGC
CAGATGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2007
Start on reference sequence 139
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PCK1
Symbol Nomenclature : PCK1
SYNONYM : PEPCK-C; PEPCK1; PEPCKC
Designation : PEP carboxykinase|phosphoenolpyruvate carboxykinase, cytosolic|phosphoenolpyruvate carboxykinase, cytosolic [GTP]|phosphoenolpyruvate carboxylase|phosphopyruvate carboxylase
Full Nomenclature : phosphoenolpyruvate carboxykinase 1 (soluble)
GENEID : 5105
GI : 61354588
GenBank Accession : AY888078
HGNC : 8724
MIM : 614168
Vega : OTTHUMG00000032825
Target GenBank: BC023978

 

Reference Sequence Alignment

  

HsCD00005778      ATGCCTCCTCAGCTGCAAAACGGCCTGAACCTCTCGGCCAAAGTTGTCCAGGGAAGCCTG
NM_002591.3       ATGCCTCCTCAGCTGCAAAACGGCCTGAACCTCTCGGCCAAAGTTGTCCAGGGAAGCCTG
                  ************************************************************

HsCD00005778      GACAGCCTGCCCCAGGCAGTGAGGGAGTTTCTCGAGAATAACGCTGAGCTGTGTCAGCCT
NM_002591.3       GACAGCCTACCCCAGGCAGTGAGGGAGTTTCTCGAGAATAACGCTGAGCTGTGTCAGCCT
                  ********.***************************************************

HsCD00005778      GATCACATCCACATCTGTGACGGCTCTGAGGAGGAGAATGGGCGGCTTCTGGGCCAGATG
NM_002591.3       GATCACATCCACATCTGTGACGGCTCTGAGGAGGAGAATGGGCGGCTTCTGGGCCAGATG
                  ************************************************************

HsCD00005778      GAGGAAGAGGGCATCCTCAGGCGGCTGAAGAAGTATGACAACTGCTGGTTGGCTCTCACT
NM_002591.3       GAGGAAGAGGGCATCCTCAGGCGGCTGAAGAAGTATGACAACTGCTGGTTGGCTCTCACT
                  ************************************************************

HsCD00005778      GACCCCAGGGATGTGGCCAGGATCGAAAGCAAGACGGTTATCGTCACCCAAGAGCAAAGA
NM_002591.3       GACCCCAGGGATGTGGCCAGGATCGAAAGCAAGACGGTTATCGTCACCCAAGAGCAAAGA
                  ************************************************************

HsCD00005778      GACACAGTGCCCATCCCCAAAACAGGCCTCAGCCAGCTCGGTCGCTGGATGTCAGAGGAG
NM_002591.3       GACACAGTGCCCATCCCCAAAACAGGCCTCAGCCAGCTCGGTCGCTGGATGTCAGAGGAG
                  ************************************************************

HsCD00005778      GATTTTGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTAC
NM_002591.3       GATTTTGAGAAAGCGTTCAATGCCAGGTTCCCAGGGTGCATGAAAGGTCGCACCATGTAC
                  ************************************************************

HsCD00005778      GTCATCCCATTCAGCATGGGGCCGCTGGGCTCACCTCTGTCGAAGATCGGCATCGAGCTG
NM_002591.3       GTCATCCCATTCAGCATGGGGCCGCTGGGCTCGCCTCTGTCAAAGATCGGCATCGAGCTG
                  ********************************.********.******************

HsCD00005778      ACGGATTCGCCCTACGTGGTGGCCAGCATGCGGATCATGACGCGGATGGGCACGCCCGTC
NM_002591.3       ACGGATTCACCCTACGTGGTGGCCAGCATGCGGATCATGACGCGGATGGGCACGCCCGTC
                  ********.***************************************************

HsCD00005778      CTGGAAGCACTGGGCGATGGGGAGTTTGTCAAATGCCTCCATTCTGTGGGGTGCCCTCTG
NM_002591.3       CTGGAAGCAGTGGGCGATGGGGAGTTTGTCAAATGCCTCCATTCTGTGGGGTGCCCTCTG
                  ********* **************************************************

HsCD00005778      CCTTTACAAAAGCCTTTGGTCAACAACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCC
NM_002591.3       CCTTTACAAAAGCCTTTGGTCAACAACTGGCCCTGCAACCCGGAGCTGACGCTCATCGCC
                  ************************************************************

HsCD00005778      CACCTGCCTGACCGCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTG
NM_002591.3       CACCTGCCTGACCGCAGAGAGATCATCTCCTTTGGCAGTGGGTACGGCGGGAACTCGCTG
                  ************************************************************

HsCD00005778      CTCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGGAGGAAGGGTGG
NM_002591.3       CTCGGGAAGAAGTGCTTTGCTCTCAGGATGGCCAGCCGGCTGGCCAAGGAGGAAGGGTGG
                  ************************************************************

HsCD00005778      CTGGCAGAGCACATGCTGGTTCTGGGTATAACCAACCCTGAGGGTGAGAAGAAGTACCTG
NM_002591.3       CTGGCAGAGCACATGCTGATTCTGGGTATAACCAACCCTGAGGGTGAGAAGAAGTACCTG
                  ******************.*****************************************

HsCD00005778      GCGGCCGCATTTCCCAGCGCCTGCGGGAAGACCAACCTGGCCATGATGAACCCCAGCCTC
NM_002591.3       GCGGCCGCATTTCCCAGCGCCTGCGGGAAGACCAACCTGGCCATGATGAACCCCAGCCTC
                  ************************************************************

HsCD00005778      CCCGGGTGGAAGGTTGAGTGCGTCGGGGATGACATTGCCTGGATGAAGTTTGACGCACAA
NM_002591.3       CCCGGGTGGAAGGTTGAGTGCGTCGGGGATGACATTGCCTGGATGAAGTTTGACGCACAA
                  ************************************************************

HsCD00005778      GGTCATTTAAGGGCCATCAACCCAGAAAATGGCTTTTTCGGTGTCGCTCCTGGGACTTCA
NM_002591.3       GGTCATTTAAGGGCCATCAACCCAGAAAATGGCTTTTTCGGTGTCGCTCCTGGGACTTCA
                  ************************************************************

HsCD00005778      GTGAAGACCAACCCCAATGCCATCAAGACCATCCAGAAGAACACAATCTTTACCAATGTG
NM_002591.3       GTGAAGACCAACCCCAATGCCATCAAGACCATCCAGAAGAACACAATCTTTACCAATGTG
                  ************************************************************

HsCD00005778      GCCGAGACCAGCGACGGGGGCGTTTACTGGGAAGGCATTGATGAGCCGCTAGCTTCAGGT
NM_002591.3       GCCGAGACCAGCGACGGGGGCGTTTACTGGGAAGGCATTGATGAGCCGCTAGCTTCAGGT
                  ************************************************************

HsCD00005778      GTCACCATCACGTCCTGGAAGAATAAGGAGTGGAGCTCAGAGGATGGGGAACCTTGTGCC
NM_002591.3       GTCACCATCACGTCCTGGAAGAATAAGGAGTGGAGCTCAGAGGATGGGGAACCTTGTGCC
                  ************************************************************

HsCD00005778      CACCCCAACTCGAGGTTCTGCACCCCTGCCAGCCAGTGCCCCATCATTGATGCTGCCTGG
NM_002591.3       CACCCCAACTCGAGGTTCTGCACCCCTGCCAGCCAGTGCCCCATCATTGATGCTGCCTGG
                  ************************************************************

HsCD00005778      GAGTCTCCGGAAGGTGTTCCCATTGAAGGCATTATCTTTGGAGGCCGTAGACCTGCTGGT
NM_002591.3       GAGTCTCCGGAAGGTGTTCCCATTGAAGGCATTATCTTTGGAGGCCGTAGACCTGCTGGT
                  ************************************************************

HsCD00005778      GTCCCTCTAGTCTATGAAGCTCTCAGCTGGCAACATGGAGTCTTTGTGGGGGCGGCCATG
NM_002591.3       GTCCCTCTAGTCTATGAAGCTCTCAGCTGGCAACATGGAGTCTTTGTGGGGGCGGCCATG
                  ************************************************************

HsCD00005778      AGATCAGAGGCCACAGCGGCTGCAGAACATAAAGGCAAAATCATCATGCATGACCCCTTT
NM_002591.3       AGATCAGAGGCCACAGCGGCTGCAGAACATAAAGGCAAAATCATCATGCATGACCCCTTT
                  ************************************************************

HsCD00005778      GCCATGCGGCCCTTCTTTGGCTACAACTTCGGCAAATACCTGGCCCACTGGCTTAGCATG
NM_002591.3       GCCATGCGGCCCTTCTTTGGCTACAACTTCGGCAAATACCTGGCCCACTGGCTTAGCATG
                  ************************************************************

HsCD00005778      GCCCAGCACCCAGCAGCCAAACTGCCCAAGATCTTCCATGTCAACTGGTTCCGGAAGGAC
NM_002591.3       GCCCAGCACCCAGCAGCCAAACTGCCCAAGATCTTCCATGTCAACTGGTTCCGGAAGGAC
                  ************************************************************

HsCD00005778      AAGGAAGGCAAATTCCTCTGGCCAGGCTTTGGAGAGAACTCCAGGGTGCTGGAGTGGATG
NM_002591.3       AAGGAAGGCAAATTCCTCTGGCCAGGCTTTGGAGAGAACTCCAGGGTGCTGGAGTGGATG
                  ************************************************************

HsCD00005778      TTCAACCGGATCGATGGAAAAGCCAGCACCAAGCTCACGCCCATAGGCTACATCCCCAAG
NM_002591.3       TTCAACCGGATCGATGGAAAAGCCAGCACCAAGCTCACGCCCATAGGCTACATCCCCAAG
                  ************************************************************

HsCD00005778      GAGGATGCCCTGAACCTGAAAGGCCTGGGGCACATCAACATGATGGAGCTTTTCAGCATC
NM_002591.3       GAGGATGCCCTGAACCTGAAAGGCCTGGGGCACATCAACATGATGGAGCTTTTCAGCATC
                  ************************************************************

HsCD00005778      TCCAAGGAATTCTGGGAGAAGGAGGTGGAAGACATCGAGAAGTATCTGGAGGATCAAGTC
NM_002591.3       TCCAAGGAATTCTGGGAGAAGGAGGTGGAAGACATCGAGAAGTATCTGGAGGATCAAGTC
                  ************************************************************

HsCD00005778      AATGCCGACCTCCCCTGTGAAATCGAGAGAGAGATCCTTGCCTTGAAGCAAAGAATAAGC
NM_002591.3       AATGCCGACCTCCCCTGTGAAATCGAGAGAGAGATCCTTGCCTTGAAGCAAAGAATAAGC
                  ************************************************************

HsCD00005778      CAGATGTTG
NM_002591.3       CAGATGTAA
                  *******:.

Pathways

NCI : FOXA2 and FOXA3 transcription factor networks
Panther : Pyruvate metabolism
Reactome : Abacavir metabolism
Reactome : Abacavir transport and metabolism
Reactome : Developmental Biology
Reactome : Disease
Reactome : Gluconeogenesis
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Myoclonic epilepsy of Lafora
Reactome : Transcriptional regulation of white adipocyte differentiation
WikiPathway : Adipogenesis
WikiPathway : Glycolysis and Gluconeogenesis

Protein

UniProt : P35558
HPRD : 02028

Clone

Cloning Information : 159241
HIP Master Clone ID : 134776
Original Clone ID : FLH159241.01L

Organism


TAX_ID : 9606
Species Specific ID: 5105

Genome

Chromosome : 20
Map Location : 20q13.31
Ensembl : ENSG00000124253

Reagents

Labome : PCK1-antibody