DNASU Plasmid Repository • 480.965.5697 | Email

SLC10A1 (H. sapiens ) in pPICZa

TOP

Explanation of Terms


Gene: Gene Symbol:  SLC10A1
Gene Name:  solute carrier family 10 (sodium/bile acid cotransporter), member 1
Sequence             
Original Clone ID: TPDB-0096
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pPICZa               Format:  FUSION
Source: Center for the X-ray Structure Determination of Human Transporters
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI:Biology
Center for the X-ray Structure Determination of Human Transporters
HsCD00583085

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1044nts         Open reading frame : 12 to 1055
Reference Sequence Alignment

ATAAGTCTAGAGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACT
TTGGCAAGCGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCA
TCATGCTCTCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGC
CTAAAGGGCTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTG
TGCTGGGCAAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCT
GCTCACCTGGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACC
TCAGCATTGTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCC
TGTACATCTACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAG
GCATCGTGATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAAT
CCAAACGGCCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGT
GCAGTGTGGCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCA
TGACACCACTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTT
ATGTTCTCTCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGTACTGTCAGCATGGAGA
CTGGATGCCAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAG
TCATTGGACCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGC
TTCTCCTCATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAA
AAATGATCTACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCA
CCTACAAAGGGGAGGACTGCTCCCCTTGCACAGCCGGTACCAGAGGTTCTCACCACCATC
ACCACCATCACCACCATCACTAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
aaaaaccatggactacaaggacgatgacgataagtctaga

3' Linker Sequence:
ggtaccagaggttctcaccaccatcaccaccatcaccaccatcactaataa

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  Pichia    Marker:  zeocin
Host Type:  bacterial    Marker:  zeocin
Bacterial Selection Condition:  50 ug/ml zeocin
Growth Condition:  Growth in low salt LB with 50ug/ml zeocin at 37 degrees C
Comments:  None
Protein Expression Results: ProteinExpressed: Protin_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Not_Applicable
Find experimental protocols in TransportPDB-0096
Recommended expression in: Pichia Pastoris, KM71H
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pPICZa

pPICZa in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  AOX1
Reverse:  pAOX1 Reverse
Description: with tag/fusion/marker assay, multiple cloning site clone, expression in Pichia pastoris, yeast expression expression with AOX1 and MCS and c-myc and His and TEF1 and EM7 and CYC1 and pUC ori and ZeoR; zeocin resistance in bacterial, zeocin resistance in Pichia;
Comments: None
Size (bp): 3329
Parent Vector: None
Empty Vector: None
Properties: expression in Pichia pastoris, multiple cloning site, with tag/fusion/marker, yeast expression
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS multiple cloning site 932 1011
bacterial origin pUC ori pUC origin 2602 3275
promoter EM7 EM7 promoter 1831 1898
promoter AOX1 AOX1 promoter 1 941
promoter TEF1 fragment containing TEF1 promoter 1419 1830
selectable marker ZeoR Zeocin resistance 1899 2273
tag c-myc N-terminal C-myc tag 1012 1044
tag His C-terminal 6xHis tag 1057 1077
trxn termination sequence CYC1 CYC1 transcription termination region 2274 2591

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLC10A1
Symbol Nomenclature : SLC10A1
SYNONYM : NTCP
Designation : Na(+)/bile acid cotransporter|Na(+)/taurocholate transport protein|Na/taurocholate cotransporting polypeptide|cell growth-inhibiting gene 29 protein|growth-inhibiting protein 29|sodium/bile acid cotransporter|sodium/taurocholate cotransporter|sodium/taurocholate cotransporting polypeptide|solute carrier family 10 (sodium/bile acid cotransporter family), member 1|solute carrier family 10 member 1
Full Nomenclature : solute carrier family 10 (sodium/bile acid cotransporter), member 1
GENEID : 6554
Locus Tag : GIG29
GI : 4506971
GenBank Accession : NM_003049
HGNC : 10905
MIM : 182396
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00583085      ATAAGTCTAGAGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACT
NM_003049.3       --------ATGGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACT
                          * .*************************************************

HsCD00583085      TTGGCAAGCGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCA
NM_003049.3       TTGGCAAGCGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCA
                  ************************************************************

HsCD00583085      TCATGCTCTCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGC
NM_003049.3       TCATGCTCTCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGC
                  ************************************************************

HsCD00583085      CTAAAGGGCTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTG
NM_003049.3       CTAAAGGGCTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTG
                  ************************************************************

HsCD00583085      TGCTGGGCAAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCT
NM_003049.3       TGCTGGGCAAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCT
                  ************************************************************

HsCD00583085      GCTCACCTGGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACC
NM_003049.3       GCTCACCTGGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACC
                  ************************************************************

HsCD00583085      TCAGCATTGTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCC
NM_003049.3       TCAGCATTGTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCC
                  ************************************************************

HsCD00583085      TGTACATCTACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAG
NM_003049.3       TGTACATCTACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAG
                  ************************************************************

HsCD00583085      GCATCGTGATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAAT
NM_003049.3       GCATCGTGATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAAT
                  ************************************************************

HsCD00583085      CCAAACGGCCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGT
NM_003049.3       CCAAACGGCCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGT
                  ************************************************************

HsCD00583085      GCAGTGTGGCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCA
NM_003049.3       GCAGTGTGGCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCA
                  ************************************************************

HsCD00583085      TGACACCACTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTT
NM_003049.3       TGACACCACTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTT
                  ************************************************************

HsCD00583085      ATGTTCTCTCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGTACTGTCAGCATGGAGA
NM_003049.3       ATGTTCTCTCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGCACTGTCAGCATGGAGA
                  ******************************************* ****************

HsCD00583085      CTGGATGCCAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAG
NM_003049.3       CTGGATGCCAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAG
                  ************************************************************

HsCD00583085      TCATTGGACCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGC
NM_003049.3       TCATTGGACCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGC
                  ************************************************************

HsCD00583085      TTCTCCTCATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAA
NM_003049.3       TTCTCCTCATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAA
                  ************************************************************

HsCD00583085      AAATGATCTACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCA
NM_003049.3       AAATGATCTACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCA
                  ************************************************************

HsCD00583085      CCTACAAAGGGGAGGACTGCTCCCCTTGCACAGCCGGTACCAGAGGTTCTCACCACCATC
NM_003049.3       CCTACAAAGGGGAGGACTGCTCCCCTTGCACAGCCTAG----------------------
                  *********************************** .                       

HsCD00583085      ACCACCATCACCACCATCACTAATAA
NM_003049.3       --------------------------
                                            

Pathways

Reactome : Bile acid and bile salt metabolism
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Recycling of bile acids and salts

Protein

Structural Annotation Wiki : TransportPDB-0096
HPRD : 01672

Clone

Cloning Information : 634420
Original Clone ID : TPDB-0096

Experimental

TargetTrack - Experimental data : TransportPDB-0096

Organism


TAX_ID : 9606
Species Specific ID: 6554

Genome

Chromosome : 14
Map Location : 14q24.1

Reagents

Labome : SLC10A1-antibody