DNASU Plasmid Repository • 480.965.5697 | Email

Dret_1524 (Desulfohalobium retbaense DSM 5692) in pMCSG73 (Bacterial Expression)

TOP

Explanation of Terms


Gene: Gene Symbol:  Dret_1524
Gene Name:  putative PAS/PAC sensor protein
Sequence             
Original Clone ID: APC103373.103
Keyword: None
Species: Desulfohalobium retbaense DSM 5692
Type: cDNA
Vector Name: pMCSG73               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Midwest Center for Structural Genomics
Argonne National Laboratory
PSI:Biology
Shonda Clancy
DrCD00583434

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1230nts         Open reading frame : 51 to 1280

GGTCTCATCCACAGTTCGAGAAGGAGAACCTGTACTTCCAATCCAATGCCATGCCTCATT
GCCACACTTCGGGCTCATCCTCGCAAGCGAGTACCCTCCAGGCCATCCTGGAAACCGCTG
TTGACGGCATTGTCGTCATTACCCCCCAGGGGACCATCCAGGCGGTCAACAAGGCCATCA
GCACCATTTTTGGGTATTCCCGAGAATGGCTCCTCGGCCAGCCGGTGTCTGTGCTTATGC
CCGAGCCCTACCGGAGCACACATCAATCGTTTATCCAGAGGTACCTGCAAACAGGCGAAG
GCCATATTTTGGGGGTTGGAGGCCGCGAGGTGCCCGGGCGCACATCCGACGGCTCCATTA
TCCCCCTTGAGTTGGGGGTCAGCGAAATCACTTCTGGAGACGACCATCTCTTTGCGGCAA
TTTTACGGGATATAACTGAACGCAAAGCGAGCCAACAGGCCCTCATGGAAAGCTACCTGG
AGTTGGAAAATAAACAAAAATTGCTGGACAAAGATCTGGAGGCGGCGGCCAATATTCAAC
TCAGTCTTTTACCGTCCAATTTTTCCCCTCTCCCGGGGCTCGACGTGGGGTGGGTCTTTG
ATCCCAGTCTTGAAATCGGCGGAGACATTTTCAACCTCGTTCCCTTGCAAACGGGGCATT
TGGGGATGTACATCCTGGACGTCAGCGGCCACGGGGTCCCTGCGGCTTTGGTAGCCGTTT
CCGCGGCCCAGGCCATGTACCGGCACACCCTGGTGCGCAGCGAATCTTGGCCGGGACGGG
AAGGGCCCCCAACTCCTCCGGCAACAGTGCTGGAACAGCTGGACGCCGAGTTTCCCTTGG
AACGCTTCGACACCTATTTTACCATGTCCTATGTGGTAATGGACCTCGAAAGTGCAACGT
TGCACTATTCCAACGCCGGGCATCCGGCTCCGCTCTTGATCCGCAATTCAGGGGAGGTAG
TCTCGCTGGAGACCGAAGGAACGCTCATCGGGCTCGGGGGGCTCCGTCCTTTTACCACCG
AACAGGACACGTTGCACCCTGGTGATGTCTTGGTCCTGTATACCGACGGGATCTACGAGC
AGCGCAATCCTGCCGGAACGCCGTATGGAAGGGAGCGCATGGTCACGGTTTTGCGCCAAA
ACCGGAACTCCTCGGCCCAAAATATGGCCGCGGCTCTTCATGAATCCTTGCGCACTTTTG
CCAAAACTGACGCGTTCGAGGACGATGTTTCCCTGTTGTGCGTCAAATCCCTGCCGACAG
CAGCACATGAAGATAATTAACATTGGAAGTGGATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
g909a,V303V
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in MCSG-APC103373
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG73

pMCSG73 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MCSG73F
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and TVMV-cleavable N-terminal NusA tag and TEV-cleavable N-terminal 6xHis and StrepII tag; Contains rate argU and ileX tRNA genes; ampicillin resistance in bacteria; ligation independent cloning.
Comments: None
Size (bp): 6227
Parent Vector: Name: pMCSG53
Description:
Empty Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 4220 4808
ligation independent cloning LIC ligation independent cloning site 138 16
promoter T7 T7 promoter 1779 1795
protease cleavage site TEV TEV protease cleavage site 155 175
protease cleavage site TVMV TVMV protease cleavage site 218 238
repressor binding site lac operator lac operator 1754 1776
repressor protein gene LacI LacI CDS 2832 3791
selectable marker AmpR ampicillin resistance gene 4979 5839
tRNA ileX ileX tRNA gene 2378 2529
tRNA argU argU tRNA 1862 2218
tag NusA N-terminal NusA 249 1708
tag His N-terminal 6xHis tag 200 217
tag strep N-terminal StrepII tag 176 199
trxn termination sequence T7 term T7 terminator 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : Dret_1524
GENEID : 8419353
Locus Tag : Dret_1524
GI : 257797873
Target GenBank: None

 

Protein

SMART domain : PAS : PAS domain
SMART domain : PP2C_SIG : Sigma factor PP2C-like phosphatases
Structural Annotation Wiki : MCSG-APC103373

Clone

Cloning Information : 601988
Original Clone ID : APC103373.103

Experimental

TargetTrack - Experimental data : MCSG-APC103373

Organism


TAX_ID : 485915
Species Specific ID: 8419353