DNASU Plasmid Repository • 480.965.5697 | Email

argC (Salmonella typhimurium LT2) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  argC
Gene Name:  N-acetyl-gamma-glutamyl-phosphate reductase
Sequence             
Original Clone ID: APC24139
Keyword: None
Species: Salmonella typhimurium LT2
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Midwest Center for Structural Genomics
Argonne National Laboratory
PSI:Biology
StCD00584341

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1005nts         Open reading frame : 51 to 1055

CTTCTGGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCAATGCCATGTTGAATA
CGCTGATTGTAGGCGCTAGCGGTTATGCGGGCGCAGAGCTTGTAAGCTACGTAAATCGCC
ACCCACATATGACCATAACCGCTTTGACCGTCTCAGCGCAAAGCAATGATGCAGGAAAGT
TAATTTCTGATTTACATCCGCAGTTAAAAGGGATTGTCGACCTGCCATTGCAACCGATGT
CGGATGTACGTGACTTTAGCGCAGATGTTGATGTGGTGTTCCTGGCGACAGCGCATGAAG
TGAGCCACGATCTGGCGCCGCAATTTTTACAGGCCGGATGCGTCGTATTCGATCTTTCCG
GCGCGTTTCGGGTAAACGATCGCGCCTTCTATGAAAAGTATTACGGATTTACTCATCAGT
ATCCTGAGCTGCTGGAGCAGGCGGTGTACGGTCTGGCGGAGTGGAATGTCGATAAACTGA
ACACGGCGAATCTGATTGCGGTTCCTGGTTGCTATCCAACCGCAGCGCAGTTGTCGCTAA
AACCGCTGATTGACGGCGGGCTTCTCGATCTGACGCAGTGGCCGGTAATTAATGCCACCA
GCGGGGTGAGCGGCGCGGGGCGCAAGGCGGCAATATCGAACAGTTTCTGTGAAGTGAGTT
TGCAACCGTATGGCGTGTTTACGCATCGTCATCAGCCGGAAATCGCCGTCCATCTGGGCG
CGGAGGTCATCTTCACCCCGCATCTGGGGAATTTCCCGCGCGGGATTCTGGAAACCATTA
CCTGCCGCCTGAAAGCGGGAGTAACCCATGCGCAGGTCGCCGACGTGTTGCAAAAAGCCT
ATGGCGACAAACCGCTGGTGCGCCTGTATGACAAAGGCGTTCCGGCGTTAAAGAACGTCG
TCGGGCTGCCGTTCTGCGATATTGGTTTTGCCGTCCAGGGCGAACATCTGATTGTGGTGG
CAACCGAAGACAACTTGTTGAAAGGCGCAGCGGCGCAGGCGGTGCAGTGCGCTAATATTC
GTTTTGGCTTCGCTGAAACGCAGTCTCTTATTTAACATTGGAAGTGGATAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC24139
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : argC
GENEID : 1255648
Locus Tag : STM4121
GI : 16767386
Target GenBank: None

 

Protein

PDB - Structural Annotation : 2G17
SMART domain : Semialdhyde_dh : Semialdehyde dehydrogenase, NAD binding domain
Structural Annotation Wiki : MCSG-APC24139
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 646803
Original Clone ID : APC24139

Experimental

Structural Biology Knowledgebase : SBKB (2G17)
TargetTrack - Experimental data : MCSG-APC24139

Organism


TAX_ID : 99287
Species Specific ID: 1255648