DNASU Plasmid Repository • 480.965.5697 | Email

EF0381 (Enterococcus faecalis V583) in pMCSG7 (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EF0381
Gene Name:  hypothetical protein
Sequence             
Original Clone ID: APC28784
Keyword: None
Species: Enterococcus faecalis V583
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Argonne National Laboratory
PSI:Biology
Midwest Center for Structural Genomics
EfCD00584424

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 819nts        
Open reading frame : 46 to 864

GGTGTAGATCTGGGTACCGAGAACCTGTACTTCCAATCCAATGCCGTGCACTTGAAAAAC
AATCAAACACTCGCTAATGGCGCAACAGTTACTATCTACCCCACTACGACTGAACCAACG
AACTATGTCGTCTATTTACACGGTGGCGGGATGATTTATGGAACCAAAAGTGATTTACCA
GAAGAACTGAAGGAGCTGTTTACAAGCAATGGCTATACCGTTTTAGCACTGGACTATTTG
TTGGCTCCAAATACAAAAATCGATCACATCTTAAGGACGCTAACGGAAACCTTCCAATTG
TTAAACGAAGAGATTATTCAAAACCAGTCCTTTGGTTTGTGCGGGCGTTCCGCTGGCGGT
TATTTAATGTTACAGTTAACCAAACAATTACAAACACTAAATTTGACGCCACAATTTTTA
GTCAATTTTTACGGCTATACAGATTTAGAATTTATTAAAGAGCCACGGAAATTATTAAAG
CAAGCCATTTCCGCTAAAGAAATAGCTGCTATCGACCAAACGAAGCCTGTTTGGGATGAT
CCTTTTCTTTCTCGCTATCTGCTGTATCATTACAGTATTCAGCAAGCGCTATTGCCGCAC
TTTTACGGATTACCAGAAAACGGGGACTGGTCTGCTTACGCACTGTCAGACGAAACATTA
AAAACTTTTCCACCTTGTTTCAGTACAGCTAGCAGCTCAGACGAAGAAGTGCCGTTCCGC
TATAGCAAAAAAATCGGACGGACCATTCCTGAGAGTACCTTTAAAGCGGTTTACTATTTA
GAACATGATTTTTTAAAACAAACCAAAGATCCTTCGGTCATCACTTTATTTGAGCAATTG
GATAGCTGGTTGAAGGAACGATAACATTGGAAGTGGATAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC28784
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG7

pMCSG7 in advanced viewed

Synonyms: pMCSG-7
Sequencing Primer: Forward:  T7short
Reverse:  T7 terminator
Description: with tag/fusion/marker assay, ligation independent cloning SspI (LIC-SspI), bacterial expression, in vitro transcription expression with AmpR and His and LIC and ori and T7 and T7 term and TEV and His 2 and LacI and lac operator; ampicillin resistance in bacterial;
Comments: pET21 derivative; for routine HTP purification; SspI site used for LIC cloning
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region, SspI site used 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : EF0381
GENEID : 1199300
Locus Tag : EF0381
GI : 29342477
Target GenBank: None

 

Protein

PDB - Structural Annotation : 2QRU
Structural Annotation Wiki : MCSG-APC28784
Protein Structure Viewer

FirstGlance in Jmol
PDB ID

Style



Color





Clone

Cloning Information : 646890
Original Clone ID : APC28784

Experimental

Structural Biology Knowledgebase : SBKB (2QRU)
TargetTrack - Experimental data : MCSG-APC28784

Organism


TAX_ID : 226185
Species Specific ID: 1199300