DNASU Plasmid Repository • 480.965.5697 | Email

MDC1 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MDC1
Gene Name:  mediator of DNA-damage checkpoint 1
Sequence             
Original Clone ID: HR9209A-24-139-15.10
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Northeast Structural Genomics Consortium
PSI:Biology
HsCD00584457

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 354nts         Open reading frame : 31 to 384
Reference Sequence Alignment

ATGGGCCATCACCATCACCATCACAGCCATATGTTGAGGTGTAACGTGGAGCCAGTAGGG
CGGCTACATATCTTTAGTGGTGCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGG
AAGAATGTGGTAGGCCGAATGCCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCC
AAACAACATGCAGAGATTGAAATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGT
GGGAGCCTTAATGGTACTCAAATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGT
CACCGTCTGAGGGACCAGGAATTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGC
CTGGATGTCTCTCTGCCCTTTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR9209A
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MDC1
Symbol Nomenclature : MDC1
SYNONYM : NFBD1
Designation : homologue to Drosophila photoreceptor protein calphotin|mediator of DNA damage checkpoint 1|mediator of DNA damage checkpoint protein 1|nuclear factor with BRCT domains 1
Full Nomenclature : mediator of DNA-damage checkpoint 1
GENEID : 9656
Locus Tag : DAAP-285E11.7
GI : 132626688
GenBank Accession : NM_014641
HGNC : 21163
MIM : 607593
Vega : OTTHUMG00000031075
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275498.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275066.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275635.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
NM_014641.2         ------------------------------------------------------------
XM_005272915.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275492.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275493.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005274905.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275629.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005249498.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005274900.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275497.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275634.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275322.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005249497.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005249492.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005272909.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275321.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005272910.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275198.1      ------------------------------------------------------------
XM_005274899.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275630.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275070.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275326.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005272914.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275071.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
XM_005274904.1      ATGGGGCATCCTACTTTCCCTACCTGTCAACAGTTTCCCTCTAGAGTGGCATATTTTCAG
                                                                                

HsCD00584457        ---------------------------------------ATGGGCCATCACCATCACCAT
XM_005275327.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275498.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275066.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275635.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
NM_014641.2         ---ATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005272915.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275492.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275493.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005274905.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275629.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005249498.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005274900.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275497.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275634.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275322.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005249497.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005249492.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005272909.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275321.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005272910.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275199.1      ---ATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005249493.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275198.1      ---ATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005274899.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275630.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275070.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275326.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005272914.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275071.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275200.1      ---ATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005275065.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
XM_005274904.1      ATCATGGAGGACACCCAGGCTATTGACTGGGATGTTGAAGAAGAGGAGGAGACAGAGCAA
                                                           .:.*.  *  * ..: * **:

HsCD00584457        CACAGCCATATGTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275327.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275498.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275066.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275635.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
NM_014641.2         TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005272915.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275492.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275493.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005274905.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275629.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005249498.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005274900.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275497.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275634.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275322.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005249497.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005249492.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005272909.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275321.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005272910.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275199.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005249493.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275198.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005274899.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275630.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275070.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275326.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005272914.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275071.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275200.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005275065.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
XM_005274904.1      TCCAGTGAATCCTTGAGGTGTAACGTGGAGCCAGTAGGGCGGCTACATATCTTTAGTGGT
                     .***  *::  ************************************************

HsCD00584457        GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275327.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275498.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275066.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275635.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
NM_014641.2         GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005272915.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275492.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275493.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005274905.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275629.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005249498.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005274900.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275497.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275634.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275322.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005249497.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005249492.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005272909.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275321.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005272910.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275199.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005249493.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275198.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005274899.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275630.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275070.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275326.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005272914.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275071.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275200.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005275065.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
XM_005274904.1      GCCCATGGACCAGAAAAAGATTTCCCACTACACCTCGGGAAGAATGTGGTAGGCCGAATG
                    ************************************************************

HsCD00584457        CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275327.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275498.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275066.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275635.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
NM_014641.2         CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005272915.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275492.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275493.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005274905.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275629.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005249498.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005274900.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275497.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275634.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275322.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005249497.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005249492.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005272909.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275321.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005272910.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275199.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005249493.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275198.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005274899.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275630.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275070.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275326.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005272914.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275071.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275200.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005275065.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
XM_005274904.1      CCTGACTGCTCTGTGGCCCTGCCCTTTCCATCTATCTCCAAACAACATGCAGAGATTGAA
                    ************************************************************

HsCD00584457        ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275327.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275498.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275066.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275635.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
NM_014641.2         ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005272915.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275492.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275493.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005274905.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275629.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005249498.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005274900.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275497.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275634.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275322.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005249497.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005249492.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005272909.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275321.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005272910.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275199.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005249493.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275198.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005274899.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275630.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275070.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275326.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005272914.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275071.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275200.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005275065.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
XM_005274904.1      ATCTTAGCCTGGGACAAGGCACCTATCCTCCGAGACTGTGGGAGCCTTAATGGTACTCAA
                    ************************************************************

HsCD00584457        ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275327.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275498.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275066.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275635.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
NM_014641.2         ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005272915.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275492.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275493.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005274905.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275629.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005249498.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005274900.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275497.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275634.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275322.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005249497.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005249492.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005272909.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275321.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005272910.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275199.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005249493.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275198.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005274899.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275630.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275070.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275326.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005272914.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275071.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275200.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005275065.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
XM_005274904.1      ATCCTGAGACCTCCTAAGGTTTTGAGCCCTGGGGTGAGTCACCGTCTGAGGGACCAGGAA
                    ************************************************************

HsCD00584457        TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275327.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275498.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275066.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275635.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
NM_014641.2         TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005272915.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275492.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275493.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005274905.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275629.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005249498.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005274900.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275497.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275634.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275322.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005249497.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005249492.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005272909.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275321.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005272910.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275199.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005249493.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275198.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005274899.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275630.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275070.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275326.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005272914.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275071.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275200.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005275065.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
XM_005274904.1      TTGATTCTCTTTGCTGACTTGCTCTGCCAGTACCATCGCCTGGATGTCTCTCTGCCCTTT
                    ************************************************************

HsCD00584457        TAG---------------------------------------------------------
XM_005275327.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275498.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275066.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275635.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
NM_014641.2         GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005272915.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275492.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275493.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005274905.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275629.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005249498.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005274900.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275497.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275634.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275322.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005249497.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005249492.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005272909.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275321.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005272910.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275199.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005249493.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275198.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005274899.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275630.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275070.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275326.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005272914.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275071.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275200.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005275065.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
XM_005274904.1      GTCTCCCGGGGCCCTCTGACAGTAGAAGAGACACCCAGAGTACAGGGAGAAACTCAACCC
                     :                                                          

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275498.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275066.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275635.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
NM_014641.2         CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005272915.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275492.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275493.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005274905.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275629.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005249498.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005274900.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275497.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275634.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275322.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005249497.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005249492.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005272909.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275321.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005272910.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275199.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005249493.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275198.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005274899.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275630.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275070.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275326.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005272914.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275071.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275200.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005275065.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
XM_005274904.1      CAGAGGCTTCTGTTGGCTGAGGACTCGGAGGAGGAAGTAGATTTTCTTTCTGAAAGGCGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275498.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275066.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275635.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
NM_014641.2         ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005272915.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275492.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275493.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005274905.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275629.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005249498.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005274900.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275497.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275634.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275322.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005249497.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005249492.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005272909.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275321.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005272910.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275199.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005249493.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275198.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005274899.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275630.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275070.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275326.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005272914.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275071.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275200.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005275065.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
XM_005274904.1      ATGGTAAAAAAATCAAGGACCACATCTTCCTCTGTGATAGTTCCAGAGAGTGATGAAGAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275498.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275066.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275635.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
NM_014641.2         GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005272915.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275492.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275493.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005274905.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275629.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005249498.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005274900.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275497.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275634.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275322.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005249497.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005249492.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005272909.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275321.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005272910.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275199.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005249493.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275198.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005274899.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275630.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275070.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275326.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005272914.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275071.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275200.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005275065.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
XM_005274904.1      GGGCATTCCCCGGTCCTGGGCGGCCTTGGGCCGCCTTTTGCCTTCAATTTGAACAGTGAC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275498.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275066.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275635.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
NM_014641.2         ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005272915.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275492.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275493.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005274905.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275629.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005249498.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005274900.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275497.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275634.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275322.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005249497.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005249492.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005272909.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275321.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005272910.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275199.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005249493.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275198.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005274899.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275630.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275070.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275326.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005272914.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275071.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275200.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005275065.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
XM_005274904.1      ACAGATGTGGAAGAAGGTCAGCAACCAGCCACAGAGGAGGCCTCCTCAGCTGCCAGAAGA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275498.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275066.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275635.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
NM_014641.2         GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005272915.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275492.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275493.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005274905.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275629.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005249498.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005274900.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275497.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275634.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275322.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005249497.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005249492.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005272909.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275321.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005272910.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275199.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005249493.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275198.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005274899.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275630.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275070.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275326.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005272914.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275071.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275200.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005275065.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
XM_005274904.1      GGTGCCACTGTAGAGGCAAAGCAGTCTGAAGCTGAAGTTGTAACTGAAATCCAGCTTGAA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275498.1      AAGGATCAGCCTTTAGTGAAGGAGAAGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275066.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275635.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
NM_014641.2         AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005272915.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275492.1      AAGGATCAGCCTTTAGTGAAGGAGAAGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275493.1      AAGGATCAGCCTTTAGTGAAGGAGAAGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005274905.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275629.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005249498.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005274900.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275497.1      AAGGATCAGCCTTTAGTGAAGGAGAAGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275634.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275322.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005249497.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005249492.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005272909.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275321.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005272910.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275199.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005249493.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275198.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005274899.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275630.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275070.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275326.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005272914.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275071.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275200.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005275065.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
XM_005274904.1      AAGGATCAGCCTTTAGTGAAGGAGAGGGACAATGATACAAAAGTCAAGAGGGGTGCAGGG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275498.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275066.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275635.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
NM_014641.2         AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005272915.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275492.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275493.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005274905.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275629.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005249498.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005274900.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275497.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275634.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275322.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005249497.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005249492.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005272909.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275321.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005272910.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275199.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005249493.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275198.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005274899.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275630.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275070.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275326.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005272914.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275071.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275200.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005275065.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
XM_005274904.1      AATGGGGTGGTTCCAGCTGGGGTGATTCTGGAGAGGAGCCAACCTCCTGGAGAGGACAGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275498.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275066.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275635.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
NM_014641.2         GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005272915.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275492.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275493.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005274905.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275629.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005249498.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005274900.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275497.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275634.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275322.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005249497.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005249492.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005272909.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275321.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005272910.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275199.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005249493.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275198.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005274899.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275630.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275070.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275326.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005272914.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275071.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275200.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005275065.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
XM_005274904.1      GACACAGATGTGGATGATGACAGCAGGCCTCCTGGAAGGCCAGCTGAGGTCCATTTGGAA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275498.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275066.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275635.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
NM_014641.2         AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005272915.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275492.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275493.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005274905.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275629.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005249498.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005274900.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275497.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275634.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275322.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005249497.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005249492.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005272909.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275321.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005272910.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275199.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005249493.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275198.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005274899.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275630.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275070.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275326.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005272914.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275071.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275200.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005275065.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
XM_005274904.1      AGGGCTCAGCCTTTTGGCTTCATCGACAGCGACACTGATGCGGAAGAAGAGAGGATCCCA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275498.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275066.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275635.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
NM_014641.2         GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005272915.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275492.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275493.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005274905.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275629.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005249498.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005274900.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275497.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275634.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275322.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005249497.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005249492.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005272909.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275321.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005272910.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275199.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005249493.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275198.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005274899.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275630.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275070.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275326.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005272914.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275071.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275200.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005275065.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
XM_005274904.1      GCAACCCCAGTTGTCATTCCTATGAAGAAGAGGAAGATCTTCCATGGAGTAGGTACAAGG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275498.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275066.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275635.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
NM_014641.2         GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005272915.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275492.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275493.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005274905.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275629.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005249498.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005274900.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275497.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275634.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275322.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005249497.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005249492.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005272909.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275321.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005272910.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275199.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005249493.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275198.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005274899.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275630.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275070.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275326.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005272914.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275071.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275200.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005275065.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
XM_005274904.1      GGTCCTGGAGCACCAGGCCTGGCCCATCTGCAGGAGAGCCAGGCTGGTAGTGATACAGAT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275498.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275066.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275635.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
NM_014641.2         GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005272915.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275492.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275493.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005274905.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275629.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005249498.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005274900.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275497.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275634.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275322.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005249497.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005249492.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005272909.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275321.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005272910.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275199.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005249493.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275198.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005274899.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275630.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275070.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275326.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005272914.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275071.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275200.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005275065.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
XM_005274904.1      GTGGAAGAAGGCAAGGCCCCACAGGCTGTCCCTCTGGAGAAAAGCCAAGCTTCCATGGTT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275498.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275066.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275635.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
NM_014641.2         ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005272915.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275492.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275493.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005274905.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275629.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005249498.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005274900.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275497.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275634.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275322.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005249497.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005249492.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005272909.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275321.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005272910.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275199.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005249493.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275198.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005274899.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275630.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275070.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275326.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005272914.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275071.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275200.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005275065.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
XM_005274904.1      ATCAACAGCGATACAGATGACGAGGAAGAAGTCTCAGCAGCGCTGACTTTGGCACATCTG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275498.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275066.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275635.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
NM_014641.2         AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005272915.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275492.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275493.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005274905.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275629.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005249498.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005274900.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275497.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275634.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275322.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005249497.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005249492.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005272909.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275321.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005272910.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275199.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005249493.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275198.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005274899.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275630.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275070.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275326.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005272914.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275071.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275200.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005275065.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
XM_005274904.1      AAAGAGAGCCAGCCTGCTATATGGAACAGAGATGCAGAAGAGGACATGCCCCAACGTGTG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275498.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275066.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275635.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
NM_014641.2         GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005272915.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275492.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275493.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005274905.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275629.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005249498.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005274900.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275497.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275634.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275322.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005249497.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005249492.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005272909.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275321.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005272910.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275199.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005249493.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275198.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005274899.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275630.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275070.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275326.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005272914.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275071.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275200.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005275065.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
XM_005274904.1      GTCCTTCTGCAGCGAAGCCAAACCACCACTGAGAGAGACAGTGACACAGACGTGGAGGAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275498.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275066.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275635.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
NM_014641.2         GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005272915.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275492.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275493.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005274905.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275629.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005249498.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005274900.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275497.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275634.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275322.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005249497.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005249492.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005272909.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275321.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005272910.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275199.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005249493.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275198.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005274899.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275630.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275070.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275326.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005272914.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275071.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275200.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005275065.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
XM_005274904.1      GAAGAGCTCCCAGTGGAAAATAGAGAAGCTGTCCTCAAGGATCACACAAAGATTAGAGCC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275498.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275066.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275635.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
NM_014641.2         CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005272915.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275492.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275493.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005274905.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275629.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005249498.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005274900.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275497.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275634.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275322.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005249497.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005249492.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005272909.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275321.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005272910.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275199.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005249493.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275198.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005274899.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275630.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275070.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275326.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005272914.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275071.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275200.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005275065.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
XM_005274904.1      CTTGTTAGAGCACATTCAGAAAAGGACCAACCTCCTTTTGGGGACAGTGATGACAGTGTG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275498.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275066.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275635.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
NM_014641.2         GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005272915.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275492.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275493.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005274905.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275629.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005249498.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005274900.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275497.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275634.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275322.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005249497.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005249492.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005272909.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275321.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005272910.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275199.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005249493.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275198.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005274899.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275630.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275070.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275326.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005272914.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275071.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275200.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005275065.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
XM_005274904.1      GAAGCAGATAAGAGCTCACCTGGGATCCACCTGGAGAGAAGCCAAGCCTCCACCACAGTG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275498.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275066.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275635.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
NM_014641.2         GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005272915.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275492.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275493.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005274905.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275629.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005249498.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005274900.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275497.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275634.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275322.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005249497.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005249492.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005272909.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275321.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005272910.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275199.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005249493.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275198.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005274899.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275630.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275070.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275326.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005272914.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275071.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275200.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005275065.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
XM_005274904.1      GACATCAACACACAAGTGGAGAAGGAAGTCCCGCCAGGGTCAGCCATTATACATATAAAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275498.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275066.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275635.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
NM_014641.2         AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005272915.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275492.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275493.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005274905.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275629.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005249498.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005274900.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275497.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275634.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275322.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005249497.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005249492.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005272909.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275321.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005272910.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275199.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005249493.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275198.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005274899.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275630.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275070.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275326.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005272914.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275071.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275200.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005275065.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
XM_005274904.1      AAGCATCAGGTGTCTGTGGAGGGGACAAATCAAACAGATGTGAAAGCAGTTGGGGGACCA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275498.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275066.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275635.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
NM_014641.2         GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005272915.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275492.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275493.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005274905.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275629.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005249498.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005274900.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275497.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275634.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275322.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005249497.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005249492.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005272909.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275321.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005272910.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275199.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005249493.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275198.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005274899.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275630.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275070.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275326.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005272914.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275071.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275200.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005275065.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
XM_005274904.1      GCAAAGCTGCTTGTGGTATCTCTAGAGGAAGCCTGGCCTCTGCATGGGGACTGTGAAACA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275498.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275066.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275635.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
NM_014641.2         GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005272915.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275492.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275493.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005274905.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275629.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005249498.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005274900.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275497.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275634.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275322.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005249497.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005249492.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005272909.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275321.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005272910.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275199.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005249493.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275198.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005274899.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275630.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275070.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275326.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005272914.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275071.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275200.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005275065.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
XM_005274904.1      GATGCAGAGGAGGGCACCTCCCTAACAGCCTCAGTAGTTGCAGATGTAAGAAAGAGCCAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275498.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275066.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275635.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
NM_014641.2         CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005272915.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275492.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275493.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005274905.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275629.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005249498.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005274900.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275497.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275634.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275322.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005249497.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005249492.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005272909.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275321.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005272910.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275199.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005249493.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275198.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005274899.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275630.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275070.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275326.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005272914.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275071.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275200.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005275065.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
XM_005274904.1      CTTCCAGCAGAAGGGGATGCTGGGGCAGAGTGGGCTGCAGCTGTTCTTAAGCAGGAGAGA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275498.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275066.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275635.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
NM_014641.2         GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005272915.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275492.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275493.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005274905.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275629.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005249498.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005274900.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275497.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275634.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275322.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005249497.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005249492.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005272909.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275321.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005272910.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275199.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005249493.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275198.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005274899.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275630.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275070.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275326.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005272914.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275071.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275200.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005275065.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
XM_005274904.1      GCTCATGAGGTGGGGGCCCAGGGTGGGCCACCTGTGGCACAAGTGGAGCAGGACCTCCCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275498.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275066.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275635.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
NM_014641.2         ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005272915.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275492.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275493.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005274905.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275629.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005249498.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005274900.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275497.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275634.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275322.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005249497.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005249492.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005272909.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275321.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005272910.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275199.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005249493.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275198.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005274899.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275630.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275070.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275326.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005272914.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275071.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275200.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005275065.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
XM_005274904.1      ATCTCAAGAGAGAACCTCACAGATCTGGTGGTGGACACAGACACTCTAGGGGAATCCACC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275498.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275066.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275635.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
NM_014641.2         CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005272915.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275492.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275493.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005274905.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275629.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005249498.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005274900.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275497.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275634.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275322.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005249497.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005249492.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005272909.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275321.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005272910.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275199.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005249493.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275198.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005274899.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275630.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275070.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275326.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005272914.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275071.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275200.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005275065.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
XM_005274904.1      CAGCCACAGAGAGAGGGAGCCCAGGTCCCCACAGGAAGGGAGAGAGAACAACATGTGGGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275498.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275066.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275635.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
NM_014641.2         GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005272915.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275492.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275493.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005274905.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275629.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005249498.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005274900.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275497.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275634.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275322.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005249497.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005249492.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005272909.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275321.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005272910.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275199.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005249493.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275198.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005274899.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275630.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275070.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275326.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005272914.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275071.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275200.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005275065.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
XM_005274904.1      GGGACCAAGGACTCTGAAGACAACTATGGTGATTCTGAAGATCTGGACCTACAAGCTACC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275498.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275066.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275635.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
NM_014641.2         CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005272915.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275492.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275493.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005274905.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275629.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005249498.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005274900.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275497.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275634.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275322.1      CAGTGCTTTCTGGAGAATCAGG---GCCTGGAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005249497.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005249492.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005272909.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275321.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005272910.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275199.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005249493.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275198.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005274899.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275630.1      CAGTGCTTTCTGGAGAATCAGGGCCTG---GAAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275070.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275326.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005272914.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275071.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275200.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005275065.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
XM_005274904.1      CAGTGCTTTCTGGAGAATCAGGGCCTGGAAGCAGTCCAGAGCATGGAGGATGAACCTACC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275498.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275066.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275635.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
NM_014641.2         CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005272915.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275492.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275493.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005274905.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275629.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005249498.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005274900.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275497.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275634.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275322.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005249497.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005249492.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005272909.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275321.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005272910.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275199.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005249493.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275198.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005274899.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275630.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275070.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275326.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005272914.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275071.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275200.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005275065.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
XM_005274904.1      CAGGCCTTCATGTTGACTCCACCCCAAGAGCTTGGCCCTTCCCATTGCAGCTTCCAGACA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACAG--------------------------------------------------------
XM_005275498.1      ACAG--------------------------------------------------------
XM_005275066.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275635.1      ACAG--------------------------------------------------------
NM_014641.2         ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005272915.1      ACAG--------------------------------------------------------
XM_005275492.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275493.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005274905.1      ACAG--------------------------------------------------------
XM_005275629.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005249498.1      ACAG--------------------------------------------------------
XM_005274900.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275497.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275634.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275322.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005249497.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005249492.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005272909.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275321.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005272910.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275199.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005249493.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275198.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005274899.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275630.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275070.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275326.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005272914.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005275071.1      ACAG--------------------------------------------------------
XM_005275200.1      ACAG--------------------------------------------------------
XM_005275065.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
XM_005274904.1      ACAGGTACCCTAGATGAACCATGGGAGGTCCTGGCTACACAGCCATTCTGTCTGAGAGAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275493.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275497.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275634.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275322.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005249497.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005249492.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005272909.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275321.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005272910.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275199.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005249493.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275198.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005274899.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275630.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275070.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275326.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005272914.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
XM_005274904.1      TCTGAGGACTCTGAGACCCAGCCTTTTGACACGCACCTTGAGGCCTATGGACCTTGCCTG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275493.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275497.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275634.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275322.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005249497.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005249492.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005272909.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275321.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005272910.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275199.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005249493.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275198.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005274899.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275630.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275070.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275326.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005272914.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
XM_005274904.1      TCTCCACCTAGGGCAATACCAGGAGACCAACATCCAGAGAGCCCAGTTCACACAGAGCCA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275493.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275497.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005275634.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005275322.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005249497.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005249492.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005272909.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275321.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005272910.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275199.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005249493.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275198.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005274899.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275630.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005275070.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005275326.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005272914.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGGGTATACCAAAAGAA
XM_005274904.1      ATGGGGATTCAAGGCAGAGGGAGGCAGACTGTGGATAAAGTCATGG--------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275493.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005272909.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275321.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005272910.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275198.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005274899.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275630.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      ACAGCAGAGAGGGTGGGCCCTGAGAGAGGGCCATTGGAGAGAGAAACTGAGAAACTGCTA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275493.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005272909.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275321.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005272910.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275198.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005274899.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275630.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      CCAGAAAGACAGACAGATGTGACAGGAGAGGAAGAATTAACCAAGGGGAAACAGGACAGA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275493.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005272909.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275321.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005272910.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275198.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005274899.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275630.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      GAACAAAAACAGTTGTTAGCTAGAGACACCCAGAGACAAGAATCTGACAAAAATGGGGAA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275493.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005272909.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275321.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005272910.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275198.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005274899.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275630.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      AGTGCAAGTCCTGAAAGAGATAGGGAGAGTTTGAAGGTAGAAATTGAGACATCTGAGGAA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275493.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005272909.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275321.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005272910.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275198.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005274899.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275630.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      ATACAAGAGAAACAAGTACAGAAGCAGACCCTTCCAAGCAAAGCATTTGAGAGAGAAGTA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275493.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005272909.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275321.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005272910.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275198.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005274899.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275630.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      GAGAGACCAGTAGCAAACAGAGAGTGCGATCCAGCCGAGTTAGAAGAGAAGGTGCCCAAA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275493.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005272909.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275321.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005272910.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275198.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005274899.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275630.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      GTGATCCTGGAGAGAGATACACAGAGAGGGGAGCCAGAGGGAGGGAGCCAGGACCAGAAA
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275493.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005272909.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275321.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005272910.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275198.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005274899.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275630.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      GGGCAGGCCTCCAGCCCAACACCAGAGCCTGGGGTGGGGGCGGGGGACCTTCCGGGACCT
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ------------------------------------------------------------
XM_005275498.1      ------------------------------------------------------------
XM_005275066.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275635.1      ------------------------------------------------------------
NM_014641.2         ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005272915.1      ------------------------------------------------------------
XM_005275492.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275493.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005274905.1      ------------------------------------------------------------
XM_005275629.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005249498.1      ------------------------------------------------------------
XM_005274900.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275497.1      ------------------------------------------------------------
XM_005275634.1      ------------------------------------------------------------
XM_005275322.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005249497.1      ------------------------------------------------------------
XM_005249492.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005272909.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275321.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005272910.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275199.1      ------------------------------------------------------------
XM_005249493.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275198.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005274899.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275630.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005275070.1      ------------------------------------------------------------
XM_005275326.1      ------------------------------------------------------------
XM_005272914.1      ------------------------------------------------------------
XM_005275071.1      ------------------------------------------------------------
XM_005275200.1      ------------------------------------------------------------
XM_005275065.1      ACCTCAGCCCCCGTACCTTCTGGGAGCCAGTCAGGTGGAAGGGGATCCCCAGTGAGCCCC
XM_005274904.1      ------------------------------------------------------------
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275498.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275066.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275635.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
NM_014641.2         AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005272915.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275492.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275493.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005274905.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275629.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005249498.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005274900.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275497.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275634.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275322.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005249497.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005249492.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005272909.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275321.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005272910.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275199.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005249493.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275198.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005274899.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275630.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275070.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275326.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005272914.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275071.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275200.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005275065.1      AGGAGGCATCAGAAAGGCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
XM_005274904.1      ----------------GCCTCCTGAATTGCAAGATGCCACCTGCTGAGAAGGCTTCCAGG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275498.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275066.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275635.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
NM_014641.2         ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005272915.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275492.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275493.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005274905.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275629.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005249498.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005274900.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275497.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275634.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275322.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005249497.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005249492.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005272909.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275321.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005272910.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275199.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005249493.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275198.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005274899.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275630.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275070.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275326.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005272914.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275071.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275200.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005275065.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
XM_005274904.1      ATCAGAGCTGCTGAGAAGGTTTCCAGGGGCGATCAGGAATCTCCAGATGCTTGTCTGCCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275498.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275066.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275635.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
NM_014641.2         CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005272915.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275492.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275493.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005274905.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275629.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005249498.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005274900.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275497.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275634.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275322.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005249497.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005249492.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005272909.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275321.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005272910.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275199.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005249493.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275198.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005274899.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275630.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275070.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275326.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005272914.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275071.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275200.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005275065.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
XM_005274904.1      CCTACAGTACCTGAAGCCCCAGCCCCACCCCAAAAGCCCCTTAACTCTCAGAGCCAGAAA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275498.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275066.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275635.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
NM_014641.2         CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005272915.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275492.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275493.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005274905.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275629.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005249498.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005274900.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275497.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275634.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275322.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005249497.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005249492.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005272909.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275321.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005272910.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275199.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005249493.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275198.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005274899.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275630.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275070.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275326.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005272914.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275071.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275200.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005275065.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
XM_005274904.1      CATCTTGCACCTCCGCCCCTTCTTTCTCCCCTTTTACCTTCTATCAAGCCAACCGTTCGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275498.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275066.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275635.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
NM_014641.2         AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005272915.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275492.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275493.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005274905.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275629.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005249498.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005274900.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275497.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275634.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275322.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005249497.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005249492.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005272909.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275321.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005272910.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275199.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005249493.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275198.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005274899.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275630.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275070.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275326.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005272914.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275071.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275200.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005275065.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
XM_005274904.1      AAGACCAGGCAAGATGGGAGTCAGGAAGCTCCAGAGGCTCCCTTGTCCTCAGAGCTGGAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275498.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275066.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275635.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
NM_014641.2         CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005272915.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275492.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275493.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005274905.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275629.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005249498.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005274900.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275497.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275634.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275322.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005249497.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005249492.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005272909.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275321.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005272910.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275199.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005249493.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275198.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005274899.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275630.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275070.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275326.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005272914.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275071.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275200.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005275065.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
XM_005274904.1      CCTTTCCACCCAAAGCCTAAAATTAGAACTCGGAAGTCCTCCAGAATGACACCCTTTCCA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275498.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275066.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275635.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
NM_014641.2         GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005272915.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275492.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275493.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005274905.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275629.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005249498.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005274900.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275497.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275634.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275322.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005249497.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005249492.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005272909.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275321.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005272910.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275199.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005249493.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275198.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005274899.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275630.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275070.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275326.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005272914.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275071.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275200.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005275065.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
XM_005274904.1      GCTACCTCTGCTGCCCCTGAGCCCCACCCTTCCACCTCCACAGCCCAGCCAGTCACTCCC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275498.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275066.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275635.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
NM_014641.2         AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005272915.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275492.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275493.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005274905.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275629.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005249498.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005274900.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275497.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275634.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275322.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005249497.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005249492.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005272909.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275321.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005272910.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275199.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005249493.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275198.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005274899.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275630.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275070.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275326.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005272914.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275071.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275200.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005275065.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
XM_005274904.1      AAGCCCACATCTCAGGCCACTAGGAGCAGGACAAATAGGTCCTCTGTCAAGACCCCTGAA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275498.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275066.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275635.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
NM_014641.2         CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005272915.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275492.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275493.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005274905.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275629.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005249498.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005274900.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275497.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275634.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275322.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005249497.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005249492.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005272909.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275321.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005272910.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275199.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005249493.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275198.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005274899.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275630.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275070.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275326.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005272914.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275071.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275200.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005275065.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
XM_005274904.1      CCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCTGTCACC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275498.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275066.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275635.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
NM_014641.2         TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005272915.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275492.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275493.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005274905.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275629.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005249498.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005274900.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275497.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275634.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275322.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005249497.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005249492.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005272909.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275321.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005272910.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275199.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005249493.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275198.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005274899.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275630.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275070.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275326.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005272914.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275071.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275200.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005275065.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
XM_005274904.1      TCTGAGCCCACATCTCAGGTTACTAGGGGAAGAAAAAGTAGATCCTCTGTCAAGACCCCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275498.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275066.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275635.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
NM_014641.2         GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005272915.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275492.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275493.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005274905.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275629.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005249498.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005274900.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275497.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275634.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275322.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005249497.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005249492.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005272909.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275321.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005272910.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275199.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005249493.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275198.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005274899.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275630.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275070.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275326.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005272914.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275071.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275200.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005275065.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
XM_005274904.1      GAAACAGTTGTGCCCACAGCCCTTGAGCTCCAGCCTTCCACCTCCACCGACCGACCTGTC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275498.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275066.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275635.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
NM_014641.2         ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005272915.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275492.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275493.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005274905.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275629.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005249498.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005274900.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275497.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275634.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275322.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005249497.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005249492.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005272909.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275321.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005272910.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275199.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005249493.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275198.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005274899.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275630.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275070.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275326.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005272914.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275071.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275200.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005275065.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
XM_005274904.1      ACCTCTGAACCCACCTCTCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAGACC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275498.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275066.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275635.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
NM_014641.2         CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005272915.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275492.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275493.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005274905.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275629.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005249498.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005274900.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275497.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275634.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275322.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005249497.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005249492.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005272909.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275321.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005272910.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275199.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005249493.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275198.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005274899.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275630.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275070.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275326.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005272914.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275071.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275200.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005275065.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
XM_005274904.1      CCTGAACCAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACCTCCACAGACCAGCCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275498.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275066.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275635.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
NM_014641.2         GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005272915.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275492.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275493.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005274905.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275629.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005249498.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005274900.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275497.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275634.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275322.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005249497.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005249492.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005272909.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275321.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005272910.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275199.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005249493.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275198.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005274899.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275630.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275070.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275326.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005272914.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275071.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275200.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005275065.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
XM_005274904.1      GTCACTTCTGAGCCCACATATCAGGCTACTAGGGGAAGAAAAAATAGATCCTCTGTCAAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275498.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275066.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275635.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
NM_014641.2         ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005272915.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275492.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275493.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005274905.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275629.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005249498.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005274900.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275497.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275634.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275322.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005249497.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005249492.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005272909.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275321.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005272910.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275199.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005249493.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275198.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005274899.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275630.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275070.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275326.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005272914.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275071.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275200.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005275065.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
XM_005274904.1      ACCCCTGAACCAGTTGTGCCCACAGCCCCTGAGCTCCGGCCTTCCACCTCCACAGACCGA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275498.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275066.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275635.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
NM_014641.2         CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005272915.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275492.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275493.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005274905.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275629.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005249498.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005274900.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275497.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275634.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275322.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005249497.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005249492.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005272909.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275321.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005272910.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275199.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005249493.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275198.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005274899.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275630.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275070.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275326.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005272914.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275071.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275200.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005275065.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
XM_005274904.1      CCTGTCACCCCCAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCTGTC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275498.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275066.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275635.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
NM_014641.2         AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005272915.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275492.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275493.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005274905.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275629.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005249498.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005274900.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275497.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275634.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275322.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005249497.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005249492.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005272909.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275321.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005272910.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275199.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005249493.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275198.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005274899.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275630.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275070.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275326.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005272914.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275071.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275200.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005275065.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
XM_005274904.1      AAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGATTTCCACCTCCACAGAC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275498.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275066.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275635.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
NM_014641.2         CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005272915.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275492.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275493.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005274905.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275629.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005249498.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005274900.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275497.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275634.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275322.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005249497.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005249492.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005272909.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275321.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005272910.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275199.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005249493.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275198.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005274899.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275630.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275070.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275326.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005272914.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275071.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275200.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005275065.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
XM_005274904.1      CAACCTGTCACCCCTAAGCCCACATCTCGGACCACTAGGAGCAGGACAAATATGTCCTCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275498.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275066.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275635.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
NM_014641.2         GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005272915.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275492.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275493.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005274905.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275629.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005249498.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005274900.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275497.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275634.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275322.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005249497.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005249492.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005272909.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275321.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005272910.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275199.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005249493.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275198.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005274899.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275630.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275070.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275326.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005272914.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275071.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275200.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005275065.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
XM_005274904.1      GTGAAGAACCCTGAATCAACTGTCCCTATAGCCCCTGAGCTCCCACCTTCCACCTCCACA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275498.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275066.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275635.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
NM_014641.2         GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005272915.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275492.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275493.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005274905.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275629.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005249498.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005274900.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275497.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275634.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275322.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005249497.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005249492.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005272909.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275321.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005272910.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275199.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005249493.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275198.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005274899.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275630.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275070.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275326.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005272914.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275071.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275200.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005275065.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
XM_005274904.1      GAGCAGCCTGTCACCCCTGAGCCCACATCTCGGGCTACTAGGGGAAGAAAAAATAGATCC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275498.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275066.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275635.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
NM_014641.2         TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005272915.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275492.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275493.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005274905.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275629.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005249498.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005274900.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275497.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275634.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275322.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005249497.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005249492.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005272909.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275321.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005272910.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275199.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005249493.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275198.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005274899.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275630.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275070.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275326.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005272914.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275071.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275200.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005275065.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
XM_005274904.1      TCTGGCAAGACCCCTGAAACACTTGTCCCCACAGCCCCTAAGCTCGAGCCTTCCACTTCC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275498.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275066.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275635.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
NM_014641.2         ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005272915.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275492.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275493.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005274905.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275629.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005249498.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005274900.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275497.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275634.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275322.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005249497.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005249492.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005272909.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275321.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005272910.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275199.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005249493.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275198.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005274899.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275630.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275070.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275326.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005272914.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275071.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275200.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005275065.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
XM_005274904.1      ACAGACCAACCTGTCACTCCTGAGCCCACATCTCAGGCCACCAGGGGCAGGACAAATAGG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275498.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275066.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275635.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
NM_014641.2         TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005272915.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275492.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275493.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005274905.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275629.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005249498.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005274900.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275497.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275634.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275322.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005249497.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005249492.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005272909.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275321.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005272910.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275199.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005249493.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275198.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005274899.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275630.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275070.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275326.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005272914.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275071.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275200.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005275065.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
XM_005274904.1      TCCTCTGTGAAGACCCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTCCAGCCTTCCACC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275498.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275066.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275635.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
NM_014641.2         TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005272915.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275492.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275493.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005274905.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275629.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005249498.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005274900.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275497.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275634.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275322.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005249497.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005249492.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005272909.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275321.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005272910.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275199.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005249493.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275198.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005274899.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275630.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275070.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275326.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005272914.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275071.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275200.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005275065.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
XM_005274904.1      TCCACAGACCAGCCTGTTACCCCTGAGCCTACGTCTCAGGCTACTAGGGGAAGAACAGAT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275498.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275066.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275635.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
NM_014641.2         AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005272915.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275492.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275493.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005274905.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275629.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005249498.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005274900.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275497.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275634.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275322.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005249497.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005249492.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005272909.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275321.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005272910.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275199.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005249493.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275198.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005274899.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275630.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275070.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275326.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005272914.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275071.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275200.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005275065.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
XM_005274904.1      AGATCCTCTGTCAAGACTCCTGAAACAGTTGTCCCCACAGCCCCTGAGCTACAGGCTTCC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275498.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275066.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275635.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
NM_014641.2         GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005272915.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275492.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275493.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005274905.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275629.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005249498.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005274900.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275497.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275634.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275322.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005249497.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005249492.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005272909.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275321.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005272910.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275199.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005249493.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275198.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005274899.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275630.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275070.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275326.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005272914.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275071.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275200.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005275065.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
XM_005274904.1      GCCTCCACAGACCAGCCTGTCACCTCTGAGCCCACATCTCGGACCACTAGGGGAAGAAAA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275498.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275066.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275635.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGCGCTCCAGCCT
NM_014641.2         AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005272915.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275492.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275493.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005274905.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275629.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGCGCTCCAGCCT
XM_005249498.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005274900.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275497.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275634.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGCGCTCCAGCCT
XM_005275322.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005249497.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005249492.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005272909.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275321.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005272910.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275199.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005249493.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275198.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005274899.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275630.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGCGCTCCAGCCT
XM_005275070.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275326.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005272914.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275071.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275200.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005275065.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
XM_005274904.1      AATCGGTCCTCTGTCAAGACCCCTGAAACAGTTGTGCCCGCAGCCCCTGAGCTCCAGCCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275498.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275066.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275635.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
NM_014641.2         TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005272915.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275492.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275493.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005274905.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275629.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005249498.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005274900.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275497.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275634.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275322.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005249497.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005249492.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005272909.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275321.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005272910.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275199.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005249493.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275198.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005274899.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275630.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275070.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275326.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005272914.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275071.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275200.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005275065.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
XM_005274904.1      TCCACCTCCACAGACCAACCTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGGGCAGG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275498.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275066.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275635.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
NM_014641.2         ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005272915.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275492.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275493.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005274905.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275629.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005249498.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005274900.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275497.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275634.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275322.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005249497.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005249492.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005272909.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275321.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005272910.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275199.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005249493.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275198.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005274899.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275630.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275070.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275326.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005272914.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275071.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275200.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005275065.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
XM_005274904.1      ACAAATAGGTCCTCTGTCAAGACCCCTGAATCAATTGTCCCTATAGCCCCTGAGCTTCAG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275498.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275066.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275635.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
NM_014641.2         CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005272915.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275492.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275493.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005274905.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275629.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005249498.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005274900.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275497.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275634.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275322.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005249497.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005249492.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005272909.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275321.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005272910.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275199.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005249493.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275198.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005274899.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275630.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275070.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275326.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005272914.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275071.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275200.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005275065.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
XM_005274904.1      CCTTCCACCTCCAGAAACCAGCTTGTCACCCCTGAGCCCACATCTCGGGCCACTAGGTGC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275498.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275066.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275635.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
NM_014641.2         AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005272915.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275492.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275493.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005274905.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275629.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005249498.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005274900.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275497.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275634.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275322.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005249497.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005249492.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005272909.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275321.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005272910.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275199.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005249493.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275198.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005274899.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275630.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275070.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275326.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005272914.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275071.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275200.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005275065.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
XM_005274904.1      AGGACAAATAGGTCCTCTGTCAAGACCCCTGAGCCAGTTGTCCCCACAGCCCCTGAGCCC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275498.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275066.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275635.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
NM_014641.2         CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005272915.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275492.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275493.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005274905.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275629.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005249498.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005274900.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275497.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275634.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275322.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005249497.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005249492.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005272909.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275321.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005272910.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275199.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005249493.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275198.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005274899.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275630.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275070.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275326.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005272914.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275071.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275200.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005275065.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
XM_005274904.1      CATCCTACCACCTCCACAGACCAGCCTGTCACCCCCAAGCTCACATCTAGGGCCACTAGG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275498.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275066.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005275635.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
NM_014641.2         AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005272915.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275492.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275493.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005274905.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005275629.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005249498.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005274900.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005275497.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275634.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275322.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005249497.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005249492.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005272909.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275321.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005272910.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275199.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005249493.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275198.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005274899.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005275630.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275070.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005275326.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005272914.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275071.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005275200.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCCTCTGAT
XM_005275065.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
XM_005274904.1      AGAAAGACAAATAGGTCCTCTGTCAAGACTCCCAAACCAGTTGAACCAGCAGCGTCTGAT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275498.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275066.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275635.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
NM_014641.2         CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005272915.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275492.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275493.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005274905.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275629.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005249498.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005274900.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275497.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275634.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275322.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005249497.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005249492.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005272909.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275321.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005272910.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275199.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005249493.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275198.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005274899.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275630.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275070.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275326.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005272914.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275071.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275200.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005275065.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
XM_005274904.1      CTTGAGCCTTTTACCCCCACAGACCAGTCCGTCACCCCTGAGGCCATAGCTCAGGGTGGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275498.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275066.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275635.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
NM_014641.2         CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005272915.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275492.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275493.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005274905.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275629.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005249498.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005274900.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275497.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275634.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275322.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005249497.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005249492.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005272909.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275321.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005272910.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275199.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005249493.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275198.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005274899.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275630.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275070.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275326.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005272914.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275071.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275200.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005275065.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
XM_005274904.1      CAGAGCAAAACACTGAGGTCTTCCACAGTAAGAGCTATGCCGGTTCCTACCACCCCTGAA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275498.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275066.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275635.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
NM_014641.2         TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005272915.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275492.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275493.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005274905.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275629.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005249498.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005274900.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275497.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275634.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275322.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005249497.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005249492.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005272909.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275321.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005272910.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275199.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005249493.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275198.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005274899.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275630.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275070.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275326.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005272914.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275071.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275200.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005275065.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
XM_005274904.1      TTCCAATCTCCTGTCACCACAGACCAGCCTATTTCCCCTGAGCCTATTACTCAACCCAGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275498.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275066.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275635.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
NM_014641.2         TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005272915.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275492.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275493.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005274905.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275629.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005249498.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005274900.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275497.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275634.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275322.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005249497.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005249492.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005272909.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275321.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005272910.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275199.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005249493.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275198.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005274899.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275630.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275070.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275326.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005272914.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275071.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275200.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005275065.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
XM_005274904.1      TGCATCAAGAGGCAGAGAGCCGCTGGGAACCCTGGCTCCCTCGCAGCTCCCATTGACCAT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275498.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275066.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275635.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
NM_014641.2         AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005272915.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275492.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275493.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005274905.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275629.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005249498.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005274900.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275497.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275634.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275322.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005249497.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005249492.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005272909.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275321.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005272910.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275199.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005249493.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275198.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005274899.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275630.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275070.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275326.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005272914.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275071.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275200.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005275065.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
XM_005274904.1      AAGCCTTGCTCTGCACCCTTGGAACCTAAATCCCAGGCCTCAAGGAACCAAAGATGGGGA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275498.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275066.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275635.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
NM_014641.2         GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005272915.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275492.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275493.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005274905.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275629.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005249498.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005274900.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275497.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275634.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275322.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005249497.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005249492.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005272909.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275321.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005272910.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275199.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005249493.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275198.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005274899.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275630.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275070.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275326.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005272914.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275071.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275200.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005275065.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
XM_005274904.1      GCAGTGAGAGCAGCTGAATCCCTTACAGCCATTCCTGAGCCTGCCTCTCCCCAGCTTCTT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275498.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275066.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275635.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
NM_014641.2         GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005272915.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275492.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275493.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005274905.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275629.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005249498.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005274900.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275497.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275634.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275322.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005249497.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005249492.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005272909.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275321.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005272910.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275199.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005249493.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275198.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005274899.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275630.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275070.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275326.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005272914.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275071.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275200.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005275065.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
XM_005274904.1      GAGACACCAATTCATGCCTCCCAGATCCAAAAGGTGGAACCAGCAGGTAGATCTAGGTTC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275498.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275066.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275635.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
NM_014641.2         ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005272915.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275492.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275493.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005274905.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275629.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005249498.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005274900.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275497.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275634.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275322.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005249497.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005249492.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005272909.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275321.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005272910.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275199.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005249493.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275198.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005274899.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275630.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275070.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275326.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005272914.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275071.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275200.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005275065.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
XM_005274904.1      ACCCCGGAGCTCCAGCCTAAGGCCTCTCAAAGCCGCAAGAGGTCTTTAGCTACCATGGAT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275498.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275066.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275635.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
NM_014641.2         TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005272915.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275492.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275493.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005274905.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275629.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005249498.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005274900.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275497.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275634.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275322.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005249497.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005249492.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005272909.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275321.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005272910.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275199.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005249493.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275198.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005274899.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275630.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275070.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275326.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005272914.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275071.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275200.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005275065.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
XM_005274904.1      TCACCACCACATCAAAAACAGCCCCAAAGAGGGGAAGTCTCCCAGAAGACAGTGATTATC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275498.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275066.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275635.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
NM_014641.2         AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005272915.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275492.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275493.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005274905.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275629.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005249498.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005274900.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275497.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275634.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275322.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005249497.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005249492.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005272909.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275321.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005272910.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275199.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005249493.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275198.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005274899.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275630.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275070.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275326.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005272914.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275071.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275200.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005275065.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
XM_005274904.1      AAGGAAGAGGAAGAAGATACTGCAGAGAAGCCAGGGAAGGAAGAGGATGTCGTGACTCCA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275498.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275066.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275635.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
NM_014641.2         AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005272915.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275492.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275493.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005274905.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275629.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005249498.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005274900.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275497.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275634.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275322.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005249497.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005249492.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005272909.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275321.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005272910.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275199.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005249493.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275198.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005274899.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275630.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275070.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275326.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005272914.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275071.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275200.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005275065.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
XM_005274904.1      AAACCAGGCAAGAGAAAGAGAGACCAGGCAGAGGAGGAGCCCAACAGAATACCAAGCCGC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275498.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275066.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275635.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
NM_014641.2         AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005272915.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275492.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275493.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005274905.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275629.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005249498.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005274900.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275497.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275634.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275322.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005249497.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005249492.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005272909.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275321.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005272910.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275199.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005249493.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275198.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005274899.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275630.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275070.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275326.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005272914.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275071.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275200.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005275065.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
XM_005274904.1      AGCCTCCGACGGACCAAACTTAACCAAGAATCAACAGCCCCCAAAGTGCTCTTCACAGGA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275498.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275066.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275635.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
NM_014641.2         GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005272915.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275492.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275493.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005274905.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275629.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005249498.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005274900.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275497.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275634.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275322.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005249497.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005249492.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005272909.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275321.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005272910.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275199.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005249493.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275198.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005274899.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275630.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275070.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275326.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005272914.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275071.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275200.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005275065.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
XM_005274904.1      GTGGTGGATGCTCGGGGAGAGCGGGCTGTGCTGGCACTGGGGGGAAGTCTGGCTGGTTCA
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275498.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275066.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275635.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
NM_014641.2         GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005272915.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275492.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275493.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005274905.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275629.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005249498.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005274900.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275497.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275634.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275322.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005249497.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005249492.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005272909.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275321.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005272910.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275199.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005249493.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275198.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005274899.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275630.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275070.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275326.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005272914.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275071.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275200.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005275065.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
XM_005274904.1      GCGGCAGAGGCTTCCCACCTGGTCACTGATCGCATCCGCCGGACAGTCAAGTTCCTGTGT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275498.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275066.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275635.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
NM_014641.2         GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005272915.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275492.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275493.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005274905.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275629.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005249498.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005274900.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275497.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275634.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275322.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005249497.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005249492.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005272909.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275321.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005272910.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275199.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005249493.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275198.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005274899.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275630.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275070.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275326.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005272914.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275071.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275200.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005275065.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
XM_005274904.1      GCCCTGGGGCGGGGAATCCCCATTCTGTCCCTGGACTGGCTGCATCAGTCCCGCAAGGCT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275498.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275066.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275635.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
NM_014641.2         GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005272915.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275492.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275493.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005274905.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275629.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005249498.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005274900.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275497.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275634.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275322.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005249497.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005249492.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005272909.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275321.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005272910.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275199.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005249493.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275198.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005274899.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275630.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275070.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275326.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005272914.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275071.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275200.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005275065.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
XM_005274904.1      GGTTTCTTCTTACCCCCGGATGAATATGTGGTGACCGACCCTGAGCAAGAGAAGAACTTT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275498.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275066.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275635.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
NM_014641.2         GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005272915.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275492.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275493.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005274905.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275629.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005249498.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005274900.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275497.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275634.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275322.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005249497.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005249492.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005272909.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275321.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005272910.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275199.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005249493.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275198.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005274899.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275630.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275070.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275326.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005272914.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275071.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275200.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005275065.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
XM_005274904.1      GGCTTTAGCCTTCAAGACGCACTGAGCAGGGCTCGGGAGCGAAGGCTGCTAGAGGGCTAT
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275498.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275066.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275635.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
NM_014641.2         GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005272915.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275492.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275493.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005274905.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275629.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005249498.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005274900.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275497.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275634.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275322.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005249497.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005249492.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005272909.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275321.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005272910.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275199.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005249493.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275198.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005274899.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275630.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275070.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275326.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005272914.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275071.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275200.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005275065.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
XM_005274904.1      GAGATCTATGTGACCCCTGGAGTCCAGCCACCACCACCTCAGATGGGAGAGATTATTAGC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275498.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275066.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275635.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
NM_014641.2         TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005272915.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275492.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275493.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005274905.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275629.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005249498.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005274900.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275497.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275634.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275322.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005249497.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005249492.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005272909.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275321.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005272910.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275199.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005249493.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275198.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005274899.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275630.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275070.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275326.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005272914.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275071.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275200.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005275065.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
XM_005274904.1      TGCTGTGGAGGCACATACCTACCCAGCATGCCTCGGTCCTATAAGCCTCAGAGAGTTGTG
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275498.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275066.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275635.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
NM_014641.2         ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005272915.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275492.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275493.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005274905.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275629.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005249498.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005274900.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275497.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275634.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275322.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005249497.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005249492.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005272909.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275321.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005272910.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275199.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005249493.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275198.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005274899.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275630.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275070.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275326.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005272914.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275071.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275200.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005275065.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
XM_005274904.1      ATCACATGCCCTCAGGACTTCCCTCATTGCTCCATTCCACTACGGGTTGGGCTGCCCCTC
                                                                                

HsCD00584457        ------------------------------------------------------------
XM_005275327.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275498.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275066.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275635.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
NM_014641.2         CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005272915.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275492.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275493.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005274905.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275629.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005249498.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005274900.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275497.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275634.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275322.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005249497.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005249492.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005272909.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275321.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005272910.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275199.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005249493.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275198.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005274899.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275630.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275070.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275326.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005272914.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275071.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275200.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005275065.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
XM_005274904.1      CTCTCGCCTGAGTTCCTGCTGACTGGAGTGCTGAAGCAGGAAGCCAAGCCAGAGGCCTTT
                                                                                

HsCD00584457        ---------------------------------
XM_005275327.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275498.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275066.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275635.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
NM_014641.2         GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005272915.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275492.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275493.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005274905.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275629.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005249498.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005274900.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275497.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275634.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275322.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005249497.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005249492.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005272909.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275321.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005272910.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275199.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005249493.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275198.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005274899.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275630.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275070.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275326.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005272914.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275071.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275200.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005275065.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
XM_005274904.1      GTCCTCTCCCCTTTGGAGATGTCATCCACCTGA
                                                     

Pathways

NCI : ATM pathway
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Recruitment of repair and signaling proteins to double-strand breaks

Protein

SMART domain : FHA : Forkhead associated domain
Structural Annotation Wiki : HR9209A
UniProt : Q14676
HPRD : 16252

Clone

Cloning Information : 640437
Original Clone ID : HR9209A-24-139-15.10

Experimental

TargetTrack - Experimental data : HR9209A

Organism


TAX_ID : 9606
Species Specific ID: 9656

Genome

Chromosome : 6
Map Location : 6p21.3
Ensembl : ENSG00000137337

Reagents

Labome : MDC1-antibody