DNASU Plasmid Repository • 480.965.5697 | Email

PI4KB (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PI4KB
Gene Name:  phosphatidylinositol 4-kinase, catalytic, beta
Sequence             
Original Clone ID: HR3373C-533-816-14.3
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI:Biology
Northeast Structural Genomics Consortium
HsCD00584951

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 858nts        
Open reading frame : 51 to 908
Reference Sequence Alignment

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCTCAAAG
AGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCCCCCTACGGCCATCTCCCCA
ATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGACCTTCGGCAAGAGCTTCTGG
CCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAGGAGCGAGTGCCCCTTTGGA
TCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGCATGATTGAACCAGTGGTCA
ATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTCTCCTTGCTCGATTACTTCC
TACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGTGCACAGCGCAATTTTGTGC
AAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAAGTCGAGGACAGACACAATG
GGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATCGACTTTGGCTTCATCCTCT
CCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTTAAGCTGACCACAGAGTTTG
TGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTACTACAAGATGCTGATGCTGC
AAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTGCAGATCGTGGAGATCATGC
AGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACCATTCGAAACCTCAAAGAGA
GGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTGGTGGAGCAGATGGTGGATG
GCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTCCAGTACCTCACCAACGGCA
TCATGTAGCTCGAGATCCGGCTGCTAACAAAGCCCGAAAGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a415g,K139E;t594c,Y198Y
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinPurified: Not_Tested
ProteinExpressed: Protein_Confirmed
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in HR3373C
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Gaetano T. Montleione
Jessica Bearden
Northeast Structural Genomics Consortium
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PI4KB
Symbol Nomenclature : PI4KB
SYNONYM : NPIK; PI4K-BETA; PI4K92; PI4KBETA; PI4KIIIBETA; PIK4CB
Designation : PtdIns 4-kinase beta|phosphatidylinositol 4-kinase beta|phosphatidylinositol 4-kinase, wortmannin-sensitive|type III phosphatidylinositol 4-kinase beta
Full Nomenclature : phosphatidylinositol 4-kinase, catalytic, beta
GENEID : 5298
Locus Tag : RP11-126K1.4
GI : 4505809
GenBank Accession : NM_002651
HGNC : 8984
MIM : 602758
Vega : OTTHUMG00000012348
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00584951        ------------------------------------------------------------
NM_002651.2         ATGAGATTCTTGGAAGCTCGAAGTCTGGCTGTGGCCATGGGAGATACAGTAGTGGAGCCT
NM_001198774.1      ------------------------------------ATGGGAGATACAGTAGTGGAGCCT
NM_001198773.1      ------------------------------------ATGGGAGATACAGTAGTGGAGCCT
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
NM_001198774.1      GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
NM_001198773.1      GCCCCCTTGAAGCCAACTTCTGAGCCCACTTCTGGCCCACCAGGGAATAATGGGGGGTCC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
NM_001198774.1      CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
NM_001198773.1      CTGCTAAGTGTCATCACGGAGGGGGTCGGGGAACTATCAGTGATTGACCCTGAGGTGGCC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
NM_001198774.1      CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
NM_001198773.1      CAGAAGGCCTGCCAGGAGGTGTTGGAGAAAGTCAAGCTTTTGCATGGAGGCGTGGCAGTC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
NM_001198774.1      TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
NM_001198773.1      TCTAGCAGAGGCACCCCACTGGAGTTGGTCAATGGGGATGGTGTGGACAGTGAGATCCGT
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
NM_001198774.1      TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
NM_001198773.1      TGCCTAGATGATCCACCTGCCCAGATCAGGGAGGAGGAAGATGAGATGGGGGCCGCTGTG
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
NM_001198774.1      GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
NM_001198773.1      GCCTCAGGCACAGCCAAAGGAGCAAGAAGACGGCGGCAGAACAACTCAGCTAAACAGTCT
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
NM_001198774.1      TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
NM_001198773.1      TGGCTGCTGAGGCTGTTTGAGTCAAAACTGTTTGACATCTCCATGGCCATTTCATACCTG
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
NM_001198774.1      TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
NM_001198773.1      TATAACTCCAAGGAGCCTGGAGTACAAGCCTACATTGGCAACCGGCTCTTCTGCTTTCGC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
NM_001198774.1      AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
NM_001198773.1      AACGAGGACGTGGACTTCTATCTGCCCCAGTTGCTTAACATGTACATCCACATGGATGAG
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
NM_001198774.1      GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
NM_001198773.1      GACGTGGGTGATGCCATTAAGCCCTACATAGTCCACCGTTGCCGCCAGAGCATTAACTTT
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
NM_001198774.1      TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
NM_001198773.1      TCCCTCCAGTGTGCCCTGTTGCTTGGGGCCTATTCTTCAGACATGCACATTTCCACTCAA
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
NM_001198774.1      CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
NM_001198773.1      CGACACTCCCGTGGGACCAAGCTACGGAAGCTGATCCTCTCAGATGAGCTAAAGCCAGCT
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGACACAGGGCTGTCTCCCTCC
NM_001198774.1      CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGACACAGGGCTGTCTCCCTCC
NM_001198773.1      CACAGGAAGAGGGAGCTGCCCTCCTTGAGCCCGGCCCCTGACACAGGGCTGTCTCCCTCC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
NM_001198774.1      AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
NM_001198773.1      AAAAGGACTCACCAGCGCTCTAAGTCAGATGCCACTGCCAGCATAAGTCTCAGCAGCAAC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAGGAGCTCTCCTCCAGC
NM_001198774.1      CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAG---------------
NM_001198773.1      CTGAAACGAACAGCCAGCAACCCTAAAGTGGAGAATGAGGATGAG---------------
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         ACCGAGAGTATTGATAATTCATTCAGTTCCCCTGTTCGACTGGCTCCTGAGAGAGAATTC
NM_001198774.1      ------------------------------CCTGTTCGACTGGCTCCTGAGAGAGAATTC
NM_001198773.1      ------------------------------CCTGTTCGACTGGCTCCTGAGAGAGAATTC
NM_001198775.1      ------------------------------------------------------------
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
NM_001198774.1      ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
NM_001198773.1      ATCAAGTCCCTGATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
NM_001198775.1      ------------ATGGCGATCGGCAAGCGGCTGGCCACGCTCCCCACCAAAGAGCAGAAA
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
NM_001198774.1      ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
NM_001198773.1      ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
NM_001198775.1      ACACAGAGGCTGATCTCAGAGCTCTCCCTGCTCAACCATAAGCTCCCTGCCCGAGTCTGG
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
NM_001198774.1      CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
NM_001198773.1      CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
NM_001198775.1      CTGCCCACTGCTGGCTTTGACCACCACGTGGTCCGTGTACCCCACACACAGGCTGTTGTC
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
NM_001198774.1      CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
NM_001198773.1      CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
NM_001198775.1      CTCAACTCCAAGGACAAGGCTCCCTACCTGATTTATGTGGAAGTCCTTGAATGTGAAAAC
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
NM_001198774.1      TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
NM_001198773.1      TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
NM_001198775.1      TTTGACACCACCAGTGTCCCTGCCCGGATCCCCGAGAACCGAATTCGGAGTACGAGGTCC
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
NM_001198774.1      GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
NM_001198773.1      GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
NM_001198775.1      GTAGAAAACTTGCCCGAATGTGGTATTACCCATGAGCAGCGAGCTGGCAGCTTCAGCACT
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
NM_001198774.1      GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
NM_001198773.1      GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
NM_001198775.1      GTGCCCAACTATGACAACGATGATGAGGCCTGGTCGGTGGATGACATAGGCGAGCTGCAA
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
NM_001198774.1      GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
NM_001198773.1      GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
NM_001198775.1      GTGGAGCTCCCCGAAGTGCATACCAACAGCTGTGACAACATCTCCCAGTTCTCTGTGGAC
                                                                                

HsCD00584951        ------------------------------------------------------------
NM_002651.2         AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
NM_001198774.1      AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
NM_001198773.1      AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
NM_001198775.1      AGCATCACCAGCCAGGAGAGCAAGGAGCCTGTGTTCATTGCAGCAGGGGACATCCGCCGG
                                                                                

HsCD00584951        -------------------CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCAT
NM_002651.2         CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
NM_001198774.1      CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
NM_001198773.1      CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
NM_001198775.1      CGCCTTTCGGAACAGCTGGCTCATACCCCGACAGCCTTCAAACGAGACCCAGAAGATCCT
                                       ** ::* .. ** * . : **:. *. * *.. *: * *.*

HsCD00584951        CACAGCCATATGCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_002651.2         TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_001198774.1      TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_001198773.1      TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
NM_001198775.1      TCTGCAGTTGCTCTCAAAGAGCCCTGGCAGGAGAAAGTACGGCGGATCAGAGAGGGCTCC
                     . . . :*.  ************************************************

HsCD00584951        CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_002651.2         CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_001198774.1      CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_001198773.1      CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
NM_001198775.1      CCCTACGGCCATCTCCCCAATTGGCGGCTCCTGTCAGTCATTGTCAAGTGTGGGGATGAC
                    ************************************************************

HsCD00584951        CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_002651.2         CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_001198774.1      CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_001198773.1      CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
NM_001198775.1      CTTCGGCAAGAGCTTCTGGCCTTTCAGGTGTTGAAGCAACTGCAGTCCATTTGGGAACAG
                    ************************************************************

HsCD00584951        GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_002651.2         GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_001198774.1      GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_001198773.1      GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
NM_001198775.1      GAGCGAGTGCCCCTTTGGATCAAGCCATACAAGATTCTTGTGATTTCGGCTGATAGTGGC
                    ************************************************************

HsCD00584951        ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_002651.2         ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_001198774.1      ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_001198773.1      ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
NM_001198775.1      ATGATTGAACCAGTGGTCAATGCTGTGTCCATCCATCAGGTGAAGAAACAGTCACAGCTC
                    ************************************************************

HsCD00584951        TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_002651.2         TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_001198774.1      TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_001198773.1      TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
NM_001198775.1      TCCTTGCTCGATTACTTCCTACAGGAGCACGGCAGTTACACCACTGAGGCATTCCTCAGT
                    ************************************************************

HsCD00584951        GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_002651.2         GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_001198774.1      GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_001198773.1      GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
NM_001198775.1      GCACAGCGCAATTTTGTGCAAAGTTGTGCTGGGTACTGCTTGGTCTGCTACCTGCTGCAA
                    ************************************************************

HsCD00584951        GTCGAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_002651.2         GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_001198774.1      GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_001198773.1      GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
NM_001198775.1      GTCAAGGACAGACACAATGGGAATATCCTTTTGGACGCAGAAGGCCACATCATCCACATC
                    ***.********************************************************

HsCD00584951        GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_002651.2         GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_001198774.1      GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_001198773.1      GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
NM_001198775.1      GACTTTGGCTTCATCCTCTCCAGCTCACCCCGAAATCTGGGCTTTGAGACGTCAGCCTTT
                    ************************************************************

HsCD00584951        AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_002651.2         AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_001198774.1      AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_001198773.1      AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
NM_001198775.1      AAGCTGACCACAGAGTTTGTGGATGTGATGGGCGGCCTGGATGGCGACATGTTCAACTAC
                    ************************************************************

HsCD00584951        TACAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_002651.2         TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_001198774.1      TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_001198773.1      TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
NM_001198775.1      TATAAGATGCTGATGCTGCAAGGGCTGATTGCCGCTCGGAAACACATGGACAAGGTGGTG
                    ** *********************************************************

HsCD00584951        CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_002651.2         CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_001198774.1      CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_001198773.1      CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
NM_001198775.1      CAGATCGTGGAGATCATGCAGCAAGGTTCTCAGCTTCCTTGCTTCCATGGCTCCAGCACC
                    ************************************************************

HsCD00584951        ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_002651.2         ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_001198774.1      ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_001198773.1      ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
NM_001198775.1      ATTCGAAACCTCAAAGAGAGGTTCCACATGAGCATGACTGAGGAGCAGCTGCAGCTGCTG
                    ************************************************************

HsCD00584951        GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_002651.2         GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_001198774.1      GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_001198773.1      GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
NM_001198775.1      GTGGAGCAGATGGTGGATGGCAGTATGCGGTCTATCACCACCAAACTCTATGACGGCTTC
                    ************************************************************

HsCD00584951        CAGTACCTCACCAACGGCATCATGTAGCTCGAGATCCGGCTGCTAACAAAGCCCGAAAGG
NM_002651.2         CAGTACCTCACCAACGGCATCATGTGA---------------------------------
NM_001198774.1      CAGTACCTCACCAACGGCATCATGTGA---------------------------------
NM_001198773.1      CAGTACCTCACCAACGGCATCATGTGA---------------------------------
NM_001198775.1      CAGTACCTCACCAACGGCATCATGTGA---------------------------------
                    *************************..                                 

Pathways

NCI : Integrins in angiogenesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Synthesis of PIPs at the Golgi membrane

Protein

SMART domain : PI3Kc : Phosphoinositide 3-kinase, catalytic domain
Structural Annotation Wiki : HR3373C
UniProt : Q9UBF8
HPRD : 11805

Clone

Cloning Information : 625245
Original Clone ID : HR3373C-533-816-14.3

Experimental

TargetTrack - Experimental data : HR3373C

Organism


TAX_ID : 9606
Species Specific ID: 5298

Genome

Chromosome : 1
Map Location : 1q21
Ensembl : ENSG00000143393

Reagents

Labome : PI4KB-antibody