DNASU Plasmid Repository • 480.965.5697 | Email

PLEC (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLEC
Gene Name:  plectin
Sequence             
Original Clone ID: HR6354E-4403-4606-15.3
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 24722902
Title: Polypeptide backbone, C and methyl group resonance assignments of the 24 kDa plectin repeat domain 6 from human protein plectin.
Authors: Northeast Structural Genomics Consortium
PSI:Biology
HsCD00585037

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 618nts         Open reading frame : 51 to 668

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCAGCTGG
CCTCCTGGTCAGACCCCACTGAGGAGACGGGCCCCGTGGCTGGCATCCTGGACACGGAGA
CGCTGGAGAAGGTGTCCATCACCGAGGCCATGCACCGGAACCTGGTGGATAACATCACGG
GGCAGCGGCTGCTGGAGGCGCAGGCCTGCACCGGGGGCATCATCGACCCCAGCACCGGTG
AGCGCTTCCCTGTCACCGACGCCGTCAACAAGGGCCTGGTGGACAAGATCATGGTGGACC
GCATCAACCTGGCCCAGAAGGCCTTCTGCGGCTTCGAGGACCCACGCACCAAGACCAAGA
TGTCGGCCGCCCAGGCCCTGAAGAAGGGCTGGCTCTACTACGAGGCCGGCCAGCGCTTCC
TGGAGGTGCAGTACCTGACCGGCGGCTTGATCGAGCCCGACACGCCGGGCCGCGTGCCCC
TGGACGAGGCCCTGCAGCGCGGCACGGTGGACGCCCGCACCGCACAGAAGCTGCGTGACG
TGGGCGCCTACTCCAAGTACCTCACCTGCCCTAAGACCAAGCTCAAGATCTCCTATAAGG
ACGCGCTGGACCGCAGCATGGTGGAGGAGGGCACGGGGCTGCGGCTGCTGGAGGCTGCCG
CGCAGTAGCTCGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in HR6354E
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLEC
Symbol Nomenclature : PLEC
SYNONYM : EBS1; EBSO; HD1; LGMD2Q; PCN; PLEC1; PLEC1b; PLTN
Designation : hemidesmosomal protein 1|plectin 1, intermediate filament binding protein 500kDa
Full Nomenclature : plectin
GENEID : 5339
GI : 41322923
GenBank Accession : NM_201384
HGNC : 9069
MIM : 601282
Vega : OTTHUMG00000165291
Target GenBank: None

 

Pathways

Reactome : Apoptosis
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Assembly of collagen fibrils and other multimeric structures
Reactome : Caspase-mediated cleavage of cytoskeletal proteins
Reactome : Cell junction organization
Reactome : Cell-Cell communication
Reactome : Collagen formation
Reactome : Extracellular matrix organization
Reactome : Type I hemidesmosome assembly

Protein

SMART domain : PLEC : Plectin repeat
Structural Annotation Wiki : HR6354E
UniProt : Q15149
HPRD : 03180

Clone

Cloning Information : 626744
Original Clone ID : HR6354E-4403-4606-15.3

Experimental

TargetTrack - Experimental data : HR6354E

Organism


TAX_ID : 9606
Species Specific ID: 5339

Genome

Chromosome : 8
Map Location : 8q24
Ensembl : ENSG00000178209

Reagents

Labome : PLEC-antibody