DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJSP6_nGST_DC

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJSP6_nGST_DC              
Source: Center for Personalized Diagnostics
Description: Wheat germ expression vector with a SP6 promoter and N-terminal TEV-cleavable GST tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments: None
Publications: None
Authors: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
EvNO00587843

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJSP6_nGST_DC

pJSP6_nGST_DC in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  GSTseqF
Reverse:  pF1KseqR
Description: Wheat germ expression vector with a SP6 promoter and N-terminal TEV-cleavable GST tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6247
Parent Vector: None
Properties: Gateway, acceptor (destination), cell-free expression, recombinational cloning
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3701 4383
death cassette ccdB Gateway ccdB death Cassette (DC) (removed in plasmids with inserts) 883 2537
death cassette 2 ccdB (BsrGI removed) ccdB (BsrGI removed) 2092 2397
enhancer TMV Omega TMV Omega enhancer 9 131
primer reverse primer pF1KseqR reverse sequencing primer CTTTCGGGCTTTGTTAGCAG (will sequence the insert) 2635 2654
primer forward primer GSTseqF forward sequencing primer gcaagtatatagcatggcct (used to sequence the insert) 718 737
primer M13 reverse M!3 reverse sequencing primer 3313 3333
promoter SP6 SP6 promoter 6231 3
protease cleavage site TEV TEV protease cleavage site EDLYFQS (used to separate expressed protein from GST) 822 842
recombination site attR1 attR1 recombination site 865 882
recombination site attR2 attR2 recombination site 2538 2555
ribosome binding site RBS pet RBS 4904 4910
selectable marker AmpR ampicillin resistance gene 4481 5140
selectable marker CmR Chloramphenicol resistance gene (removed in plasmids containing gene inserts) 1091 1747
tag GST N-terminal GST 138 803

 

Species Specific ID: None
Target GenBank: None