DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  CAPN10
Gene Name:  calpain 10
Sequence             
Original Clone ID: HR3356H-509-661-14.3
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  FUSION
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00589041

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 462nts         Open reading frame : 51 to 512
Reference Sequence Alignment

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCTGCCTG
CGGGGGAGTGGGGGACCGTGCAGCTACGGGGTTCTTGGAGAGTCGGCCAGACGGCGGGGG
GCAGCAGGAACTTTGCCTCATACCCCACCAACCCCTGCTTCCCCTTCTCGGTCCCCGAGG
GCCCTGGCCCCCGCTGCGTCCGCATCACTCTGCATCAGCACTGCCGGCCCAGTGACACCG
AGTTCCACCCCATCGGCTTCCATATCTTCCAGGTCCCAGAGGGTGGAAGGAGCCAGGACG
CACCCCCACTGCTGCTGCAGGAGCCGCTGCTGAGCTGCGTGCCACATCGCTACGCCCAGG
AGGTGAGCCGGCTCTGCCTCCTGCCTGCAGGCACCTACAAGGTTGTGCCCTCCACCTACC
TGCCGGACACAGAGGGGGCCTTCACAGTGACCATCGCAACCAGGATTGACAGGCCATCCA
TTCACAGCCAGGAGATGCTGGGCCAGTTCCTCCAAGAGGTCTCCTAGCTCGAGATCCGGC
TGCTAACAAAGCCCGAAAGGAAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
ins@461,12
                                

5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in HR3356H
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome

Gene

 

Gene Symbol : CAPN10
Symbol Nomenclature : CAPN10
SYNONYM : CANP10; NIDDM1
Designation : calcium-activated neutral proteinase 10|calpain-10|calpain-like protease CAPN10
Full Nomenclature : calpain 10
GENEID : 11132
HGNC : 1477
MIM : 605286
Vega : OTTHUMG00000133358
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00589041      ------------------------------------------------------------
NM_023083.3       ATGCGGGCGGGCCGGGGCGCGACGCCGGCGAGGGAGCTGTTCCGGGACGCCGCCTTCCCC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GCCGCGGACTCCTCGCTCTTCTGCGACTTGTCTACGCCGCTGGCCCAGTTCCGCGAGGAC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       ATCACGTGGAGGCGGCCCCAGGAGATTTGTGCCACACCCCGGCTGTTTCCAGATGACCCA
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       CGGGAAGGGCAGGTGAAGCAGGGGCTGCTGGGGGATTGCTGGTTCCTGTGTGCCTGCGCC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GCGCTGCAGAAGAGCAGGCACCTCCTGGACCAGGTCATTCCTCCGGGACAGCCGAGCTGG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GCCGACCAGGAGTACCGGGGCTCCTTCACCTGTCGCATTTGGCAGTTTGGACGCTGGGTG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GAGGTGACCACAGATGACCGCCTGCCGTGCCTTGCAGGGAGACTCTGTTTCTCCCGCTGC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       CAGAGGGAGGATGTGTTCTGGCTCCCCTTACTGGAAAAGGTCTACGCCAAGGTCCATGGG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       TCCTACGAGCACCTGTGGGCCGGGCAGGTGGCGGATGCCCTGGTGGACCTGACCGGCGGC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       CTGGCAGAAAGATGGAACCTGAAGGGCGTAGCAGGAAGCGGAGGCCAGCAGGACAGGCCA
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GGCCGCTGGGAGCACAGGACTTGTCGGCAGCTGCTCCACCTGAAGGACCAGTGTCTGATC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       AGCTGCTGCGTGCTCAGCCCCAGAGCAGGTGCCCGGGAGCTGGGGGAGTTCCATGCCTTC
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       ATTGTCTCGGACCTGCGGGAGCTCCAGGGTCAGGCGGGCCAGTGCATCCTGCTGCTGCGG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       ATCCAGAACCCCTGGGGCCGGCGGTGCTGGCAGGGGCTCTGGAGAGAGGGGGGTGAAGGG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       TGGAGCCAGGTAGATGCAGCGGTAGCATCTGAGCTCCTGTCCCAGCTCCAGGAAGGGGAG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       TTCTGGGTGGAGGAGGAGGAGTTCCTCAGGGAGTTTGACGAGCTCACCGTTGGCTACCCG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GTCACGGAGGCCGGCCACCTGCAGAGCCTCTACACAGAGAGGCTGCTCTGCCATACGCGG
                                                                              

HsCD00589041      ---------------------------CTTTAAGAAGGAGATATACCATGGGCCATCACC
NM_023083.3       GCGCTGCCTGGGGCCTGGGTCAAGGGCCAGTCAGCAGGAGGCTGCCGGAACAACAGCGGC
                                             *: *.**.*****. : .* .:. ..** *. *

HsCD00589041      ATCACCATCACAGCCATATGCTG-------------------------------------
NM_023083.3       TTTCCCAGCAACCCCAAATTCTGGCTGCGGGTCTCAGAACCGAGTGAGGTGTACATTGCC
                  :* .*** **.. ***:** ***                                     

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GTCCTGCAGAGATCCAGGCTGCACGCGGCGGACTGGGCAGGCCGGGCCCGGGCACTGGTG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GGTGACAGTCATACTTCGTGGAGCCCAGCGAGCATCCCGGGCAAGCACTACCAGGCTGTG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       GGTCTGCACCTCTGGAAGGTAGAGAAGCGGCGGGTCAATCTGCCTAGGGTCCTGTCCATG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       CCCCCCGTGGCTGGCACCGCGTGCCATGCATACGACCGGGAGGTCCACCTGCGTTGTGAG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       CTCTCACCGGGCTACTACCTGGCTGTCCCCAGCACCTTCCTGAAGGACGCGCCAGGGGAG
                                                                              

HsCD00589041      ------------------------------------------------------------
NM_023083.3       TTCCTGCTCCGAGTCTTCTCTACCGGGCGAGTCTCCCTTAGCGCCATCAGGGCAGTGGCC
                                                                              

HsCD00589041      ---------------------------CCTGCGGGGGAGTGGGGGACCGTGCAGCTACGG
NM_023083.3       AAGAACACCACCCCCGGGGCAGCCCTGCCTGCGGGGGAGTGGGGGACCGTGCAGCTACGG
                                             *********************************

HsCD00589041      GGTTCTTGGAGAGTCGGCCAGACGGCGGGGGGCAGCAGGAACTTTGCCTCATACCCCACC
NM_023083.3       GGTTCTTGGAGAGTCGGCCAGACGGCGGGGGGCAGCAGGAACTTTGCCTCATACCCCACC
                  ************************************************************

HsCD00589041      AACCCCTGCTTCCCCTTCTCGGTCCCCGAGGGCCCTGGCCCCCGCTGCGTCCGCATCACT
NM_023083.3       AACCCCTGCTTCCCCTTCTCGGTCCCCGAGGGCCCTGGCCCCCGCTGCGTCCGCATCACT
                  ************************************************************

HsCD00589041      CTGCATCAGCACTGCCGGCCCAGTGACACCGAGTTCCACCCCATCGGCTTCCATATCTTC
NM_023083.3       CTGCATCAGCACTGCCGGCCCAGTGACACCGAGTTCCACCCCATCGGCTTCCATATCTTC
                  ************************************************************

HsCD00589041      CAGGTCCCAGAGGGTGGAAGGAGCCAGGACGCACCCCCACTGCTGCTGCAGGAGCCGCTG
NM_023083.3       CAGGTCCCAGAGGGTGGAAGGAGCCAGGACGCACCCCCACTGCTGCTGCAGGAGCCGCTG
                  ************************************************************

HsCD00589041      CTGAGCTGCGTGCCACATCGCTACGCCCAGGAGGTGAGCCGGCTCTGCCTCCTGCCTGCA
NM_023083.3       CTGAGCTGCGTGCCACATCGCTACGCCCAGGAGGTGAGCCGGCTCTGCCTCCTGCCTGCG
                  ***********************************************************.

HsCD00589041      GGCACCTACAAGGTTGTGCCCTCCACCTACCTGCCGGACACAGAGGGGGCCTTCACAGTG
NM_023083.3       GGCACCTACAAGGTTGTGCCCTCCACCTACCTGCCGGACACAGAGGGGGCCTTCACAGTG
                  ************************************************************

HsCD00589041      ACCATCGCAACCAGGATTGACAGGCCATCCATTCACAGCCAGGAGATGCTGGGCCAGTTC
NM_023083.3       ACCATCGCAACCAGGATTGACAGGCCATCCATTCACAGCCAGGAGATGCTGGGCCAGTTC
                  ************************************************************

HsCD00589041      CTCCAAGAGGTCTCCTAGCTCGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAG
NM_023083.3       CTCCAAGAGGTCTCCGTCATGGCAGTGATGAAAACCTAA---------------
                  *************** : .* *...* . *.:.. .:.*               

Protein

SMART domain : calpain_III :
Structural Annotation Wiki : HR3356H
HPRD : 05595

Clone

Cloning Information : 627686
Original Clone ID : HR3356H-509-661-14.3

Experimental

TargetTrack - Experimental data : HR3356H

Organism


TAX_ID : 9606
Species Specific ID: None

Genome

Chromosome : 2
Map Location : 2q37.3
Ensembl : ENSG00000142330