DNASU Plasmid Repository • 480.965.5697 | Email

lmo2366 (Listeria monocytogenes EGD-e) in pMCSG73 (Bacterial Expression)

TOP

Explanation of Terms


Gene: Gene Symbol:  lmo2366
Gene Name:  similar to transcription regulator DeoR family
Sequence             
Original Clone ID: APC106887.104
Keyword: None
Species: Listeria monocytogenes EGD-e
Type: cDNA
Vector Name: pMCSG73               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Midwest Center for Structural Genomics
Argonne National Laboratory
PSI:Biology
Michael Endres
LmCD00589228

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 759nts         Open reading frame : 45 to 803

ATCCACAGTTCGAGAAGGAGAACCTGTACTTCCAATCCAATGCCGTGTTATCTATCGAAC
GAAAGCGTGCCATCGTCCAATATGTAAAAAGTAGAAAAATAGCAACAGTTAGCGAACTTG
CCAAACATTTTGAAGTCCACGAAGCAACCATTCGCCGCGATTTAACCTCTTTAGAAAAAG
ACAAAAAGCTAAAAAGAACCCACGGCGGAGTTATGATAGAAGAAAAAGTAGTTTCCGAAC
CGAATTGGAAAAAACGAAGCGAAGTGCGCTACGAAGAAAAACAACGCATTGCCACATTAG
CAGCGACAATGGTCAAAGACGGCGATACAATCATTCTTGACGCCGGAACAACAACCGGAC
ACATCGCAACCGCATTAAAAGACCGTTCCAAACTAACCGTCATAACAAACGATATCAACG
TAGCTTCCATTATGCGTTTCTCTCCGTCTAAAGTAATTGTGACAGGCGGCGTCATCTACC
CAGAAACTTTCATCCTTAACGGTATGATTACAAGTGGAACCTTGCAGAGCATTCACGTAC
ATAAAGCATTTGTAACCACACCAGCTCTCGATATCGACAAAGGTTTAATGCACTACGACG
AATACCTCATCCCAGCTAAGCAACAAATGCTCCACTCAGCTGATGAAGTTATCTTAGTAA
CAGATCACACCAAGTTCGGCCGCATTTCACTTTACAAATACGCAGCCCTAGACGAAATCT
CTTCCATTATCACCGGAAAAGAAATAGATCCGGTACTAAAAGAACAATTTGAAGAAAAAG
GAATGCAAATTTATACAACATAACATTGGAAGTGGATAACTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in MCSG-APC106887
Recommended expression in: E.coli BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG73

pMCSG73 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MCSG73F
Reverse:  T7 terminator
Description: Bacterial expression vector with a T7 promoter and TVMV-cleavable N-terminal NusA tag and TEV-cleavable N-terminal 6xHis and StrepII tag; Contains rate argU and ileX tRNA genes; ampicillin resistance in bacteria; ligation independent cloning.
Comments: None
Size (bp): 6227
Parent Vector: Name: pMCSG53
Description:
Empty Vector: None
Properties: bacterial expression, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
PSI:Biology
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 origin of replication 4220 4808
ligation independent cloning LIC ligation independent cloning site 138 16
promoter T7 T7 promoter 1779 1795
protease cleavage site TEV TEV protease cleavage site 155 175
protease cleavage site TVMV TVMV protease cleavage site 218 238
repressor binding site lac operator lac operator 1754 1776
repressor protein gene LacI LacI CDS 2832 3791
selectable marker AmpR ampicillin resistance gene 4979 5839
tRNA ileX ileX tRNA gene 2378 2529
tRNA argU argU tRNA 1862 2218
tag NusA N-terminal NusA 249 1708
tag His N-terminal 6xHis tag 200 217
tag strep N-terminal StrepII tag 176 199
trxn termination sequence T7 term T7 terminator 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : lmo2366
Designation : hypothetical protein
GENEID : 984418
Locus Tag : lmo2366
GI : 16804404
Target GenBank: None

 

Clone

Cloning Information : 631604
Original Clone ID : APC106887.104

Experimental

TargetTrack - Experimental data : MCSG-APC106887

Organism


TAX_ID : 169963
Species Specific ID: 984418