DNASU Plasmid Repository • 480.965.5697 | Email

ENC1 (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ENC1
Gene Name:  ectodermal-neural cortex 1 (with BTB domain)
Sequence             
Original Clone ID: HR2957-13-589-15.6
Keyword: full length protein truncation
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: Northeast Structural Genomics Consortium
Rutgers University
PSI:Biology
HsCD00589495

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 1737nts         Open reading frame : 51 to 1787
Reference Sequence Alignment

ACTTTAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGGCCAGCA
GCGGCTCCATTAACATCTATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTC
ACCTGAATCTTTTACGCCAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATA
GGACCTTCCCTTGCCACCGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGT
TCAGTGGTGGCCTGAAAGAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACC
CAGAAGTCTTGGAGCTGCTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAG
AAAATGCAGAATCGCTCCTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATG
CATGTGCAGAGTTCCTGGAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGC
TGTCTGATGCACACCAGTGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCA
ACTTCCAAACCATCAGGAAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGC
AACTCTTGTCCAGTGAAGAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAA
TTAACTGGATCAGCTATGACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGA
CAGTAAGGCTGGCACTTCTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAAC
TCATCACCAAGCAGAGAAAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGA
AAATCCTGCAGAATGACGGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCC
ATGCCCTCTTCCTTCTGGGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACC
AGAAGGCCAAAGAAATCATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTG
CATGTGCGATTGGCTGCAAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCT
CGAAAGATGTCTGGGTTTATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGC
TGGTGGCCAGGTTTGGCCATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGG
GGCACACGGCCGCAACTGGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAG
AACATTATGACCCCACAATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTA
GCAACGCCGCAGTAGTGAGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCA
GTCATGACAAGCTCCCCAAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTAC
CGGCCACCTGTCCCCAGCCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTT
TTATTATGGGGGGTGATACAGAATTCTCTGCCTGCTCTGCCTATAAATTCAACAGTGAGA
CTTACCAGTGGACCAAAGTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGG
CCTCTGGAAACAAACTCTACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTT
TGGACTGCTACGATCCAACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGC
TGATTCCTACTGCATTTGTCAGCACCTGGAAACATCTGCCTTCTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
a1032g,S344S;t1491c,A497A;

g1527a,K509K
                                

5' Linker Sequence:
ATGGGCCATCACCATCACCATCACAGCCAT

3' Linker Sequence:
CTCGAGATCCGGCTGC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Tested_Not_Found
ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
Find experimental protocols in HR2957
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Jessica Bearden
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ENC1
Symbol Nomenclature : ENC1
SYNONYM : CCL28; ENC-1; KLHL35; KLHL37; NRPB; PIG10; TP53I10
Designation : ectoderm-neural cortex protein 1|ectodermal-neural cortex 1 (with BTB-like domain)|kelch-like 35|kelch-like family member 37|kelch-like protein 37|nuclear matrix protein NRP/B|nuclear restricted protein, BTB domain-like (brain)|p53-induced gene 10 protein|tumor protein p53 inducible protein 10
Full Nomenclature : ectodermal-neural cortex 1 (with BTB domain)
GENEID : 8507
GenBank Accession : NR_046318
HGNC : 3345
MIM : 605173
Vega : OTTHUMG00000102059
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00589495        ACTTTAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGGCCAGCA
NM_001256574.1      -----------------ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCA
NM_003633.3         -----------------ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCA
NM_001256575.1      -----------------ATGTCAGTCAGTGTGCATGAGAACCGCAAGTCCAGGGCCAGCA
                                     *  : .* *..* : *** * .* *.**.  . * ********

HsCD00589495        GCGGCTCCATTAACATCTATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTC
NM_001256574.1      GCGGCTCCATTAACATCTATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTC
NM_003633.3         GCGGCTCCATTAACATCTATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTC
NM_001256575.1      GCGGCTCCATTAACATCTATCTGTTTCACAAGTCCTCCTACGCTGACAGCGTCCTCACTC
                    ************************************************************

HsCD00589495        ACCTGAATCTTTTACGCCAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATA
NM_001256574.1      ACCTGAATCTTTTACGCCAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATA
NM_003633.3         ACCTGAATCTTTTACGCCAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATA
NM_001256575.1      ACCTGAATCTTTTACGCCAGCAGCGTCTCTTCACTGACGTCCTTCTCCATGCCGGAAATA
                    ************************************************************

HsCD00589495        GGACCTTCCCTTGCCACCGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGT
NM_001256574.1      GGACCTTCCCTTGCCACCGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGT
NM_003633.3         GGACCTTCCCTTGCCACCGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGT
NM_001256575.1      GGACCTTCCCTTGCCACCGGGCAGTGCTGGCTGCATGCAGTCGCTACTTTGAGGCCATGT
                    ************************************************************

HsCD00589495        TCAGTGGTGGCCTGAAAGAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACC
NM_001256574.1      TCAGTGGTGGCCTGAAAGAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACC
NM_003633.3         TCAGTGGTGGCCTGAAAGAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACC
NM_001256575.1      TCAGTGGTGGCCTGAAAGAGAGCCAGGACAGTGAGGTCAACTTTGACAATTCCATCCACC
                    ************************************************************

HsCD00589495        CAGAAGTCTTGGAGCTGCTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAG
NM_001256574.1      CAGAAGTCTTGGAGCTGCTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAG
NM_003633.3         CAGAAGTCTTGGAGCTGCTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAG
NM_001256575.1      CAGAAGTCTTGGAGCTGCTGCTTGACTATGCGTACTCCTCCCGGGTCATCATCAATGAAG
                    ************************************************************

HsCD00589495        AAAATGCAGAATCGCTCCTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATG
NM_001256574.1      AAAATGCAGAATCGCTCCTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATG
NM_003633.3         AAAATGCAGAATCGCTCCTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATG
NM_001256575.1      AAAATGCAGAATCGCTCCTGGAAGCTGGTGACATGCTGGAGTTTCAAGACATCCGGGATG
                    ************************************************************

HsCD00589495        CATGTGCAGAGTTCCTGGAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGC
NM_001256574.1      CATGTGCAGAGTTCCTGGAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGC
NM_003633.3         CATGTGCAGAGTTCCTGGAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGC
NM_001256575.1      CATGTGCAGAGTTCCTGGAAAAGAACCTGCATCCCACCAACTGCCTGGGCATGCTGCTGC
                    ************************************************************

HsCD00589495        TGTCTGATGCACACCAGTGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCA
NM_001256574.1      TGTCTGATGCACACCAGTGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCA
NM_003633.3         TGTCTGATGCACACCAGTGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCA
NM_001256575.1      TGTCTGATGCACACCAGTGCACCAAGCTGTACGAACTATCTTGGAGAATGTGTCTCAGCA
                    ************************************************************

HsCD00589495        ACTTCCAAACCATCAGGAAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGC
NM_001256574.1      ACTTCCAAACCATCAGGAAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGC
NM_003633.3         ACTTCCAAACCATCAGGAAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGC
NM_001256575.1      ACTTCCAAACCATCAGGAAGAATGAAGATTTCCTCCAGCTGCCCCAGGACATGGTAGTGC
                    ************************************************************

HsCD00589495        AACTCTTGTCCAGTGAAGAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAA
NM_001256574.1      AACTCTTGTCCAGTGAAGAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAA
NM_003633.3         AACTCTTGTCCAGTGAAGAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAA
NM_001256575.1      AACTCTTGTCCAGTGAAGAGCTGGAGACAGAGGATGAAAGGCTTGTGTACGAGTCTGCAA
                    ************************************************************

HsCD00589495        TTAACTGGATCAGCTATGACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGA
NM_001256574.1      TTAACTGGATCAGCTATGACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGA
NM_003633.3         TTAACTGGATCAGCTATGACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGA
NM_001256575.1      TTAACTGGATCAGCTATGACCTGAAGAAGCGCTATTGCTACCTCCCAGAACTGTTGCAGA
                    ************************************************************

HsCD00589495        CAGTAAGGCTGGCACTTCTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAAC
NM_001256574.1      CAGTAAGGCTGGCACTTCTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAAC
NM_003633.3         CAGTAAGGCTGGCACTTCTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAAC
NM_001256575.1      CAGTAAGGCTGGCACTTCTGCCAGCCATCTATCTCATGGAGAATGTGGCCATGGAGGAAC
                    ************************************************************

HsCD00589495        TCATCACCAAGCAGAGAAAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGA
NM_001256574.1      TCATCACCAAGCAGAGAAAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGA
NM_003633.3         TCATCACCAAGCAGAGAAAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGA
NM_001256575.1      TCATCACCAAGCAGAGAAAGAGTAAGGAAATTGTGGAAGAGGCCATCAGGTGCAAACTGA
                    ************************************************************

HsCD00589495        AAATCCTGCAGAATGACGGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCC
NM_001256574.1      AAATCCTGCAGAATGACGGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCC
NM_003633.3         AAATCCTGCAGAATGACGGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCC
NM_001256575.1      AAATCCTGCAGAATGACGGTGTGGTAACCAGCCTCTGTGCCCGACCTCGGAAAACTGGCC
                    ************************************************************

HsCD00589495        ATGCCCTCTTCCTTCTGGGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACC
NM_001256574.1      ATGCCCTCTTCCTTCTGGGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACC
NM_003633.3         ATGCCCTCTTCCTTCTGGGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACC
NM_001256575.1      ATGCCCTCTTCCTTCTGGGAGGACAGACTTTCATGTGTGACAAGTTGTATCTGGTAGACC
                    ************************************************************

HsCD00589495        AGAAGGCCAAAGAAATCATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTG
NM_001256574.1      AGAAGGCCAAAGAAATCATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTG
NM_003633.3         AGAAGGCCAAAGAAATCATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTG
NM_001256575.1      AGAAGGCCAAAGAAATCATTCCCAAGGCTGACATTCCCAGCCCAAGAAAAGAGTTTAGTG
                    ************************************************************

HsCD00589495        CATGTGCGATTGGCTGCAAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCT
NM_001256574.1      CATGTGCGATTGGCTGCAAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCT
NM_003633.3         CATGTGCGATTGGCTGCAAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCT
NM_001256575.1      CATGTGCGATTGGCTGCAAAGTGTACATTACTGGGGGGCGGGGGTCTGAAAATGGGGTCT
                    ************************************************************

HsCD00589495        CGAAAGATGTCTGGGTTTATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGC
NM_001256574.1      CAAAAGATGTCTGGGTTTATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGC
NM_003633.3         CAAAAGATGTCTGGGTTTATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGC
NM_001256575.1      CAAAAGATGTCTGGGTTTATGATACCCTGCACGAGGAGTGGTCCAAGGCTGCCCCCATGC
                    *.**********************************************************

HsCD00589495        TGGTGGCCAGGTTTGGCCATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGG
NM_001256574.1      TGGTGGCCAGGTTTGGCCATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGG
NM_003633.3         TGGTGGCCAGGTTTGGCCATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGG
NM_001256575.1      TGGTGGCCAGGTTTGGCCATGGCTCTGCTGAACTGAAGCACTGCCTGTATGTGGTTGGGG
                    ************************************************************

HsCD00589495        GGCACACGGCCGCAACTGGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAG
NM_001256574.1      GGCACACGGCCGCAACTGGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAG
NM_003633.3         GGCACACGGCCGCAACTGGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAG
NM_001256575.1      GGCACACGGCCGCAACTGGCTGCCTCCCGGCCTCCCCCTCAGTCTCTCTAAAGCAGGTAG
                    ************************************************************

HsCD00589495        AACATTATGACCCCACAATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTA
NM_001256574.1      AACATTATGACCCCACAATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTA
NM_003633.3         AACATTATGACCCCACAATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTA
NM_001256575.1      AACATTATGACCCCACAATCAACAAATGGACCATGGTGGCCCCACTCCGAGAAGGCGTTA
                    ************************************************************

HsCD00589495        GCAACGCCGCAGTAGTGAGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCA
NM_001256574.1      GCAACGCCGCAGTAGTGAGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCA
NM_003633.3         GCAACGCCGCAGTAGTGAGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCA
NM_001256575.1      GCAACGCCGCAGTAGTGAGTGCCAAACTTAAGTTATTTGCTTTCGGAGGTACCAGTGTCA
                    ************************************************************

HsCD00589495        GTCATGACAAGCTCCCCAAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTAC
NM_001256574.1      GTCATGACAAGCTCCCCAAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTAC
NM_003633.3         GTCATGACAAGCTCCCCAAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTAC
NM_001256575.1      GTCATGACAAGCTCCCCAAAGTTCAGTGTTACGATCAGTGTGAAAACAGGTGGACTGTAC
                    ************************************************************

HsCD00589495        CGGCCACCTGTCCCCAGCCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTT
NM_001256574.1      CGGCCACCTGTCCCCAGCCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTT
NM_003633.3         CGGCCACCTGTCCCCAGCCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTT
NM_001256575.1      CGGCCACCTGTCCCCAGCCCTGGCGTTACACAGCAGCAGCTGTGCTGGGGAACCAGATTT
                    ************************************************************

HsCD00589495        TTATTATGGGGGGTGATACAGAATTCTCTGCCTGCTCTGCCTATAAATTCAACAGTGAGA
NM_001256574.1      TTATTATGGGGGGTGATACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGA
NM_003633.3         TTATTATGGGGGGTGATACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGA
NM_001256575.1      TTATTATGGGGGGTGATACAGAATTCTCTGCCTGCTCTGCTTATAAATTCAACAGTGAGA
                    **************************************** *******************

HsCD00589495        CTTACCAGTGGACCAAAGTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGG
NM_001256574.1      CTTACCAGTGGACCAAGGTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGG
NM_003633.3         CTTACCAGTGGACCAAGGTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGG
NM_001256575.1      CTTACCAGTGGACCAAGGTGGGAGATGTGACAGCAAAGCGCATGAGCTGCCATGCTGTGG
                    ****************.*******************************************

HsCD00589495        CCTCTGGAAACAAACTCTACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTT
NM_001256574.1      CCTCTGGAAACAAACTCTACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTT
NM_003633.3         CCTCTGGAAACAAACTCTACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTT
NM_001256575.1      CCTCTGGAAACAAACTCTACGTGGTTGGAGGATACTTTGGCATTCAGCGATGCAAGACTT
                    ************************************************************

HsCD00589495        TGGACTGCTACGATCCAACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGC
NM_001256574.1      TGGACTGCTACGATCCAACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGC
NM_003633.3         TGGACTGCTACGATCCAACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGC
NM_001256575.1      TGGACTGCTACGATCCAACATTAGACGTGTGGAACAGCATCACCACTGTCCCGTACTCGC
                    ************************************************************

HsCD00589495        TGATTCCTACTGCATTTGTCAGCACCTGGAAACATCTGCCTTCTTAG
NM_001256574.1      TGATTCCTACTGCATTTGTCAGCACCTGGAAACATCTGCCTTCTTAA
NM_003633.3         TGATTCCTACTGCATTTGTCAGCACCTGGAAACATCTGCCTTCTTAA
NM_001256575.1      TGATTCCTACTGCATTTGTCAGCACCTGGAAACATCTGCCTTCTTAA
                    **********************************************.

Protein

SMART domain : BTB : Broad-Complex, Tramtrack and Bric a brac
SMART domain : Kelch :
SMART domain : BACK : BTB And C-terminal Kelch
Structural Annotation Wiki : HR2957
UniProt : O14682
HPRD : 05529

Clone

Cloning Information : 626941
Original Clone ID : HR2957-13-589-15.6

Experimental

TargetTrack - Experimental data : HR2957

Organism


TAX_ID : 9606
Species Specific ID: 8507

Genome

Chromosome : 5
Map Location : 5q13
Ensembl : ENSG00000171617

Reagents

Labome : ENC1-antibody