DNASU Plasmid Repository • 480.965.5697 | Email

PIK3C2A (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3C2A
Gene Name:  phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Sequence             
Original Clone ID: HR6244D-850-1400-15.5
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Rutgers University
PSI:Biology
Northeast Structural Genomics Consortium
HsCD00590522

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 1659nts        
Open reading frame : 14 to 1672
Reference Sequence Alignment

CCATCACAGCCATATGACAACTCCTCAAGTTGACAGAAGCATTATACAGCAACATAACTT
AGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCATAAAGACTCATC
ACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTATTATTGCTTCAA
ACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAATGGGTTAATCT
TGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTAATTGCATTGGA
ACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTGACCTGGATTGA
GGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAAGCTTTGAAATA
TGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCATTGGGAAATAT
CCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGATGTACAGTTTAG
TACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAACGACTTAGAGA
AGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCAGAAAAAGTAAG
GCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAACGAGTACAGTC
CTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTGGCAAAAGAATT
AAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAAGTCACAATGGT
GAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTCG
GCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGGCTTAAAGAAGG
ACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGATCGAGGCATGGT
GGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATATGGTGTGACAGG
ATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCCTCTGAAGAAGA
ATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGTGTAGCCACCTA
TGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGCACGGGACACAT
GTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGCAGCTTCAAAAG
GGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAATGGGGGTGAAAA
GCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAG
AAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCAGGGTTACCAGA
ACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCCCAAACTACAGA
CGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGAAGCATTGCCAC
AAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
ProteinExpressed: Tested_Not_Found
Find experimental protocols in HR6244D
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Gaetano T. Montleione
Jessica Bearden
Northeast Structural Genomics Consortium
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3C2A
Symbol Nomenclature : PIK3C2A
SYNONYM : CPK; PI3-K-C2(ALPHA); PI3-K-C2A
Designation : C2-containing phosphatidylinositol kinase|PI3K-C2-alpha|PI3K-C2alpha|phosphatidylinositol 4-phosphate 3-kinase C2 domain-containing subunit alpha|phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing subunit alpha|phosphoinositide 3-kinase-C2-alpha|phosphoinositide-3-kinase, class 2, alpha polypeptide|ptdIns-3-kinase C2 subunit alpha
Full Nomenclature : phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
GENEID : 5286
GI : 157671929
GenBank Accession : NM_002645
HGNC : 8971
MIM : 603601
Vega : OTTHUMG00000166036
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
NM_002645.2         ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
NM_002645.2         ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
NM_002645.2         AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
NM_002645.2         ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
NM_002645.2         TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
NM_002645.2         GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
NM_002645.2         CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
NM_002645.2         CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
NM_002645.2         ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
NM_002645.2         TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
NM_002645.2         ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
NM_002645.2         ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
NM_002645.2         AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
NM_002645.2         AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
NM_002645.2         GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
NM_002645.2         AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
NM_002645.2         AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
NM_002645.2         ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
NM_002645.2         ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
NM_002645.2         ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
XM_005252980.1      ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
NM_002645.2         CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
XM_005252980.1      CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
NM_002645.2         AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
XM_005252980.1      AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
NM_002645.2         TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
XM_005252980.1      TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
NM_002645.2         GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
XM_005252980.1      GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
NM_002645.2         CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
XM_005252980.1      CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
NM_002645.2         ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
XM_005252980.1      ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
NM_002645.2         GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
XM_005252980.1      GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
NM_002645.2         TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
XM_005252980.1      TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
NM_002645.2         GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
XM_005252980.1      GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
NM_002645.2         GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
XM_005252980.1      GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
NM_002645.2         AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
XM_005252980.1      AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
NM_002645.2         TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
XM_005252980.1      TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
NM_002645.2         GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
XM_005252980.1      GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
NM_002645.2         AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
XM_005252980.1      AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
NM_002645.2         ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
XM_005252980.1      ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
NM_002645.2         GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
XM_005252980.1      GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
NM_002645.2         TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
XM_005252980.1      TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
NM_002645.2         TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
XM_005252980.1      TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
NM_002645.2         CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
XM_005252980.1      CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
NM_002645.2         CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
XM_005252980.1      CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
NM_002645.2         TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
XM_005252980.1      TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
NM_002645.2         CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
XM_005252980.1      CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
                                                                                

HsCD00590522        -----------CCATCACAGCCATATGACAACTCCTCAAGTTGACAGAAGCATTATACAG
XM_005252977.1      CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
NM_002645.2         CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
XM_005252980.1      CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
                               . :* * *  .:*:: *********************************

HsCD00590522        CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
XM_005252977.1      CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
NM_002645.2         CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
XM_005252980.1      CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
                    ************************************************************

HsCD00590522        AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
XM_005252977.1      AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
NM_002645.2         AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
XM_005252980.1      AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
                    ************************************************************

HsCD00590522        TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
XM_005252977.1      TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
NM_002645.2         TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
XM_005252980.1      TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
                    ************************************************************

HsCD00590522        TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
XM_005252977.1      TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
NM_002645.2         TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
XM_005252980.1      TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
                    ************************************************************

HsCD00590522        ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
XM_005252977.1      ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
NM_002645.2         ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
XM_005252980.1      ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
                    ************************************************************

HsCD00590522        ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
XM_005252977.1      ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
NM_002645.2         ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
XM_005252980.1      ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
                    ************************************************************

HsCD00590522        GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
XM_005252977.1      GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
NM_002645.2         GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
XM_005252980.1      GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
                    ************************************************************

HsCD00590522        TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
XM_005252977.1      TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
NM_002645.2         TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
XM_005252980.1      TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
                    ************************************************************

HsCD00590522        GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
XM_005252977.1      GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
NM_002645.2         GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
XM_005252980.1      GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
                    ************************************************************

HsCD00590522        CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
XM_005252977.1      CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
NM_002645.2         CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
XM_005252980.1      CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
                    ************************************************************

HsCD00590522        GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
XM_005252977.1      GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
NM_002645.2         GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
XM_005252980.1      GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
                    ************************************************************

HsCD00590522        CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
XM_005252977.1      CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
NM_002645.2         CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
XM_005252980.1      CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
                    ************************************************************

HsCD00590522        GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
XM_005252977.1      GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
NM_002645.2         GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
XM_005252980.1      GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
                    ************************************************************

HsCD00590522        GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
XM_005252977.1      GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
NM_002645.2         GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
XM_005252980.1      GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
                    ************************************************************

HsCD00590522        GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
XM_005252977.1      GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
NM_002645.2         GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
XM_005252980.1      GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
                    ************************************************************

HsCD00590522        CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
XM_005252977.1      CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
NM_002645.2         CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
XM_005252980.1      CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
                    ************************************************************

HsCD00590522        CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
XM_005252977.1      CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
NM_002645.2         CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
XM_005252980.1      CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
                    ************************************************************

HsCD00590522        GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
XM_005252977.1      GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
NM_002645.2         GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
XM_005252980.1      GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
                    ************************************************************

HsCD00590522        TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
XM_005252977.1      TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
NM_002645.2         TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
XM_005252980.1      TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
                    ************************************************************

HsCD00590522        GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
XM_005252977.1      GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
NM_002645.2         GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
XM_005252980.1      GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
                    ************************************************************

HsCD00590522        ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
XM_005252977.1      ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
NM_002645.2         ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
XM_005252980.1      ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
                    ************************************************************

HsCD00590522        AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
XM_005252977.1      AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
NM_002645.2         AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
XM_005252980.1      AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
                    ************************************************************

HsCD00590522        GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
XM_005252977.1      GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
NM_002645.2         GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
XM_005252980.1      GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
                    ************************************************************

HsCD00590522        AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
XM_005252977.1      AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
NM_002645.2         AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
XM_005252980.1      AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
                    ************************************************************

HsCD00590522        GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
XM_005252977.1      GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
NM_002645.2         GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
XM_005252980.1      GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
                    ************************************************************

HsCD00590522        CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
XM_005252977.1      CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
NM_002645.2         CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
XM_005252980.1      CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
                    ************************************************************

HsCD00590522        AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
XM_005252977.1      AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
NM_002645.2         AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
XM_005252980.1      AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
                    ************************************************************

HsCD00590522        TAG---------------------------------------------------------
XM_005252977.1      CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
NM_002645.2         CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
XM_005252980.1      CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
                     :                                                          

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
NM_002645.2         GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
XM_005252980.1      GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
NM_002645.2         CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
XM_005252980.1      CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
NM_002645.2         CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
XM_005252980.1      CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
NM_002645.2         AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
XM_005252980.1      AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
NM_002645.2         GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
XM_005252980.1      GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
NM_002645.2         GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
XM_005252980.1      GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
NM_002645.2         GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
XM_005252980.1      GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
NM_002645.2         GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
XM_005252980.1      GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
NM_002645.2         ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
XM_005252980.1      ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
NM_002645.2         CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
XM_005252980.1      CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
NM_002645.2         CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
XM_005252980.1      CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
NM_002645.2         GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
XM_005252980.1      GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
                                                                                

HsCD00590522        ------------------------------------------------------------
XM_005252977.1      GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
NM_002645.2         GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
XM_005252980.1      GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
                                                                                

HsCD00590522        ---------------------
XM_005252977.1      ACTGCGGCAACATACTTGTAA
NM_002645.2         ACTGCGGCAACATACTTGTAA
XM_005252980.1      ACTGCGGCAACATACTTGTAA
                                         

Pathways

NCI : Integrins in angiogenesis
Panther : Angiogenesis
Panther : Axon guidance mediated by netrin
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Panther : VEGF signaling pathway
Reactome : Clathrin derived vesicle budding
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Synthesis of PIPs at the early endosome membrane
Reactome : Synthesis of PIPs at the Golgi membrane
Reactome : Synthesis of PIPs at the late endosome membrane
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : trans-Golgi Network Vesicle Budding
WikiPathway : Insulin Signaling
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 626972
Original Clone ID : HR6244D-850-1400-15.5

Experimental

TargetTrack - Experimental data : HR6244D

Organism


TAX_ID : 9606
Species Specific ID: 5286

Genome

Chromosome : 11
Map Location : 11p15.5-p14
Ensembl : ENSG00000011405

Reagents

Labome : PIK3C2A-antibody