DNASU Plasmid Repository • 480.965.5697 | Email

ATR (Homo sapiens) in pET15_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATR
Gene Name:  ataxia telangiectasia and Rad3 related
Sequence             
Original Clone ID: HR3359K-2411-2572-14.19
Keyword: targeted domain
Species: Homo sapiens
Type: cDNA
Vector Name: pET15_NESG               Format:  CLOSED
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Rutgers University
PSI:Biology
Northeast Structural Genomics Consortium
HsCD00591014

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 492nts        
Open reading frame : 51 to 542
Reference Sequence Alignment

CTTTAAGAAGGAGATATACCATGGGCCATCACCATCACCATCACAGCCATATGCTACCAA
AGTCAGCAGCTTTATCTGAAAAACTCAAAGTATTCCGAGAATTTCTCCTGCCCAGGCATC
CTCCTATTTTTCATGAGTGGTTTCTGAGAACATTCCCTGATCCTACATCATGGTACAGTA
GTAGATCAGCTTACTGCCGTTCCACTGCAGTAATGTCAATGGTTGGTTATATTCTGGGGC
TTGGAGACCGTCATGGTGAAAATATTCTCTTTGATTCTTTGACTGGTGAATGCGTACATG
TAGATTTCAATTGTCTTTTCAATAAGGGAGAAACCTTTGAAGTTCCAGAAATTGTGCCAT
TTCGCCTGACTCATAATATGGTTAATGGAATGGGTCCTATGGGAACAGAGGGTCTTTTTC
GAAGAGCATGTGAAGTTACAATGAGGCTGATGCGTGATCAGCGAGAGCCTTTAATGAGTG
TCTTAAAGACTTTTCTACATGATCCTCTTGTGGAATGGAGTAAACCAGTGAAAGGGCATT
AGCTCGAGATCCGGCTGCT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
ProteinExpressed: Tested_Not_Found
Find experimental protocols in HR3359K
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET15_NESG

pET15_NESG in advanced viewed

Synonyms: pET15, pET15-modified, pET15Cc, pET15_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds N-terminal 6x His tag; amp resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5723
Parent Vector: None
Empty Vector: EvNO00336943
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Gaetano T. Montleione
Jessica Bearden
Northeast Structural Genomics Consortium
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, EcoRI, BamHI, XhoI) 327 452
bacterial origin ori ColE1 origin of replication 3881 4563
gene fragment ROP repressor of primer ROP sequence 3281 3457
primer T7 forward T7 forward sequencing primer 481 496
primer T7 reverse T7 reverse sequencing primer 257 275
promoter T7 T7 promoter 478 497
repressor binding site lacO lacO regulatory sequence 456 478
selectable marker AmpR ampicillin resistance gene 4661 5230
tag His N-terminal 6x His tag 387 404
trxn termination sequence T7 term T7 termination sequence 257 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATR
Symbol Nomenclature : ATR
SYNONYM : FCTCS; FRP1; MEC1; SCKL; SCKL1
Designation : FRAP-related protein 1|FRAP-related protein-1|MEC1, mitosis entry checkpoint 1, homolog|Rad3 related protein|ataxia telangiectasia and Rad3-related protein|protein kinase ATR|serine/threonine-protein kinase ATR
Full Nomenclature : ataxia telangiectasia and Rad3 related
GENEID : 545
GI : 157266317
GenBank Accession : NM_001184
HGNC : 882
MIM : 601215
Vega : OTTHUMG00000159234
Target GenBank: None

 

Reference Sequence Alignment

  

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATGGGGGAACATGGCCTGGAGCTGGCTTCCATGATCCCCGCCCTGCGGGAGCTGGGCAGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCCACACCAGAGGAATATAATACAGTTGTACAGAAGCCAAGACAAATTCTGTGTCAATTC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATTGACCGGATACTTACAGATGTAAATGTTGTTGCTGTAGAACTTGTAAAGAAAACTGAC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCTCAGCCAACCTCCGTGATGTTGCTTGATTTCATCCAGCATATCATGAAATCCTCCCCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTTATGTTTGTAAATGTGAGTGGAAGCCATGAGGCCAAAGGCAGTTGTATTGAATTCAGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AATTGGATCATAACGAGACTTCTGCGGATTGCAGCAACTCCCTCCTGTCATTTGTTACAC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAGAAAATCTGTGAAGTCATCTGTTCATTATTATTTCTTTTTAAAAGCAAGAGTCCTGCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATTTTTGGGGTACTCACAAAAGAATTATTACAACTTTTTGAAGACTTGGTTTACCTCCAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGAAGAAATGTGATGGGTCATGCTGTGGAATGGCCAGTGGTCATGAGCCGATTTTTAAGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAATTAGATGAACACATGGGATATTTACAATCAGCTCCTTTGCAGTTGATGAGTATGCAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AATTTAGAATTTATTGAAGTCACTTTATTAATGGTTCTTACTCGTATTATTGCAATTGTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTTTTTAGAAGGCAAGAACTCTTACTTTGGCAGATAGGTTGTGTTCTGCTAGAGTATGGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGTCCAAAAATTAAATCCCTAGCAATTAGCTTTTTAACAGAACTTTTTCAGCTTGGAGGA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTACCAGCACAACCAGCTAGCACTTTTTTCAGCTCATTTTTGGAATTATTAAAACACCTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GTAGAAATGGATACTGACCAATTGAAACTCTATGAAGAGCCATTATCAAAGCTGATAAAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ACACTATTTCCCTTTGAAGCAGAAGCTTATAGAAATATTGAACCTGTCTATTTAAATATG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTGCTGGAAAAACTCTGTGTCATGTTTGAAGACGGTGTGCTCATGCGGCTTAAGTCTGAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTGCTAAAAGCAGCTTTGTGCCATTTACTGCAGTATTTCCTTAAATTTGTGCCAGCTGGG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TATGAATCTGCTTTACAAGTCAGGAAGGTCTATGTGAGAAATATTTGTAAAGCTCTTTTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GATGTGCTTGGAATTGAGGTAGATGCAGAGTACTTGTTGGGCCCACTTTATGCAGCTTTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAAATGGAAAGTATGGAAATCATTGAGGAGATTCAATGCCAAACTCAACAGGAAAACCTC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGCAGTAATAGTGATGGAATATCACCCAAAAGGCGTCGTCTCAGCTCGTCTCTAAACCCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCTAAAAGAGCACCAAAACAGACTGAGGAAATTAAACATGTGGACATGAACCAAAAGAGC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATATTATGGAGTGCACTGAAACAGAAAGCTGAATCCCTTCAGATTTCCCTTGAATACAGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GGCCTAAAGAATCCTGTTATTGAGATGTTAGAAGGAATTGCTGTTGTCTTACAACTGACT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTCTGTGTACTGTTCATTGTTCTCATCAAAACATGAACTGCCGTACTTTCAAGGACTGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAACATAAATCCAAGAAGAAACCTTCTGTAGTGATAACTTGGATGTCATTGGATTTTTAC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ACAAAAGTGCTTAAGAGCTGTAGAAGTTTGTTAGAATCTGTTCAGAAACTGGACCTGGAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCAACCATTGATAAGGTGGTGAAAATTTATGATGCTTTGATTTATATGCAAGTAAACAGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCATTTGAAGATCATATCCTGGAAGATTTATGTGGTATGCTCTCACTTCCATGGATTTAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCCCATTCTGATGATGGCTGTTTAAAGTTGACCACATTTGCCGCTAATCTTCTAACATTA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGCTGTAGGATTTCAGATAGCTATTCACCACAGGCACAATCACGATGTGTGTTTCTTCTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ACTCTGTTTCCAAGAAGAATATTCCTTGAGTGGAGAACAGCAGTTTACAACTGGGCCCTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAGAGCTCCCATGAAGTAATCCGGGCTAGTTGTGTTAGTGGATTTTTTATCTTATTGCAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAGCAGAATTCTTGTAACAGAGTTCCCAAGATTCTTATAGATAAAGTCAAAGATGATTCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GACATTGTCAAGAAAGAATTTGCTTCTATACTTGGTCAACTTGTCTGTACTCTTCACGGC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATGTTTTATCTGACAAGTTCTTTAACAGAACCTTTCTCTGAACACGGACATGTGGACCTC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTCTGTAGGAACTTGAAAGCCACTTCTCAACATGAATGTTCATCTTCTCAACTAAAAGCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCTGTCTGCAAGCCATTCCTTTTCCTACTGAAAAAAAAAATACCTAGTCCAGTAAAACTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTTTCATAGATAATCTACATCATCTTTGTAAGCATCTTGATTTTAGAGAAGATGAAACA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GATGTAAAAGCAGTTCTTGGAACTTTATTAAATTTAATGGAAGATCCAGACAAAGATGTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGAGTGGCTTTTAGTGGAAATATCAAGCACATATTGGAATCCTTGGACTCTGAAGATGGA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTTATAAAGGAGCTTTTTGTCTTAAGAATGAAGGAAGCATATACACATGCCCAAATATCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGAAATAATGAGCTGAAGGATACCTTGATTCTTACAACAGGGGATATTGGAAGGGCCGCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAAGGAGATTTGGTACCATTTGCACTCTTACACTTATTGCATTGTTTGTTATCCAAGTCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCATCTGTCTCTGGAGCAGCATACACAGAAATTAGAGCTCTGGTTGCAGCTAAAAGTGTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAACTGCAAAGTTTTTTCAGCCAGTATAAGAAACCCATCTGTCAGTTTTTGGTAGAATCC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTTCACTCTAGTCAGATGACAGCACTTCCGAATACTCCATGCCAGAATGCTGACGTGCGA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAACAAGATGTGGCTCACCAGAGAGAAATGGCTTTAAATACGTTGTCTGAAATTGCCAAC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GTTTTCGACTTTCCTGATCTTAATCGTTTTCTTACTAGGACATTACAAGTTCTACTACCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GATCTTGCTGCCAAAGCAAGCCCTGCAGCTTCTGCTCTCATTCGAACTTTAGGAAAACAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTAAATGTCAATCGTAGAGAGATTTTAATAAACAACTTCAAATATATTTTTTCTCATTTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GTCTGTTCTTGTTCCAAAGATGAATTAGAACGTGCCCTTCATTATCTGAAGAATGAAACA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GAAATTGAACTGGGGAGCCTGTTGAGACAAGATTTCCAAGGATTGCATAATGAATTATTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTGCGTATTGGAGAACACTATCAACAGGTTTTTAATGGTTTGTCAATACTTGCCTCATTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCATCCAGTGATGATCCATATCAGGGCCCGAGAGATATCATATCACCTGAACTGATGGCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GATTATTTACAACCCAAATTGTTGGGCATTTTGGCTTTTTTTAACATGCAGTTACTGAGC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCTAGTGTTGGCATTGAAGATAAGAAAATGGCCTTGAACAGTTTGATGTCTTTGATGAAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTAATGGGACCCAAACATGTCAGTTCTGTGAGGGTGAAGATGATGACCACACTGAGAACT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GGCCTTCGATTCAAGGATGATTTTCCTGAATTGTGTTGCAGAGCTTGGGACTGCTTTGTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CGCTGCCTGGATCATGCTTGTCTGGGCTCCCTTCTCAGTCATGTAATAGTAGCTTTGTTA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CCTCTTATACACATCCAGCCTAAAGAAACTGCAGCTATCTTCCACTACCTCATAATTGAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AACAGGGATGCTGTGCAAGATTTTCTTCATGAAATATATTTTTTACCTGATCATCCAGAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTAAAAAAGATAAAAGCCGTTCTCCAGGAATACAGAAAGGAGACCTCTGAGAGCACTGAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTTCAGACAACTCTTCAGCTCTCTATGAAGGCCATTCAACATGAAAATGTCGATGTTCGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATTCATGCTCTTACAAGCTTGAAGGAAACCTTGTATAAAAATCAGGAAAAACTGATAAAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TATGCAACAGACAGTGAAACAGTAGAACCTATTATCTCACAGTTGGTGACAGTGCTTTTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAAGGTTGCCAAGATGCAAACTCTCAAGCTCGGTTGCTCTGTGGGGAATGTTTAGGGGAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTGGGGGCGATAGATCCAGGTCGATTAGATTTCTCAACAACTGAAACTCAAGGAAAAGAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTTACATTTGTGACTGGAGTAGAAGATTCAAGCTTTGCCTATGGATTATTGATGGAGCTA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ACAAGAGCTTACCTTGCGTATGCTGATAATAGCCGAGCTCAAGATTCAGCTGCCTATGCC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATTCAGGAGTTGCTTTCTATTTATGACTGTAGAGAGATGGAGACCAACGGCCCAGGTCAC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAATTGTGGAGGAGATTTCCTGAGCATGTTCGGGAAATACTAGAACCTCATCTAAATACC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGATACAAGAGTTCTCAGAAGTCAACCGATTGGTCTGGAGTAAAGAAGCCAATTTACTTA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGTAAATTGGGTAGTAACTTTGCAGAATGGTCAGCATCTTGGGCAGGTTATCTTATTACA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAGGTTCGACATGATCTTGCCAGTAAAATTTTCACCTGCTGTAGCATTATGATGAAGCAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GATTTCAAAGTGACCATCTATCTTCTTCCACATATTCTGGTGTATGTCTTACTGGGTTGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AATCAAGAAGATCAGCAGGAGGTTTATGCAGAAATTATGGCAGTTCTAAAGCATGACGAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAGCATACCATAAATACCCAAGACATTGCATCTGATCTGTGTCAACTCAGTACACAGACT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GTGTTCTCCATGCTTGACCATCTCACACAGTGGGCAAGGCACAAATTTCAGGCACTGAAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTGAGAAATGTCCACACAGCAAATCAAACAGAAATAAGGTAGACTCAATGGTATCTACT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GTGGATTATGAAGACTATCAGAGTGTAACCCGTTTTCTAGACCTCATACCCCAGGATACT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTGGCAGTAGCTTCCTTTCGCTCCAAAGCATACACACGAGCTGTAATGCACTTTGAATCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTTATTACAGAAAAGAAGCAAAATATTCAGGAACATCTTGGATTTTTACAGAAATTGTAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTGCTATGCATGAACCTGATGGAGTGGCCGGAGTCAGTGCAATTAGAAAGGCAGAACCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TCTCTAAAAGAACAGATCCTTGAACATGAAAGCCTTGGCTTGCTGAGGGATGCCACTGCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TGTTATGACAGGGCTATTCAGCTAGAACCAGACCAGATCATTCATTATCATGGTGTAGTA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAGTCCATGTTAGGTCTTGGTCAGCTGTCTACTGTTATCACTCAGGTGAATGGAGTGCAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTAACAGGTCCGAGTGGACAGATGAATTAAACACGTACAGAGTGGAAGCAGCTTGGAAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTGTCACAGTGGGATTTGGTGGAAAACTATTTGGCAGCAGATGGAAAATCTACAACATGG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGTGTCAGACTGGGACAGCTATTATTATCAGCCAAAAAAAGAGATATCACAGCTTTTTAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GACTCACTGAAACTAGTGAGAGCAGAACAAATTGTACCTCTTTCAGCTGCAAGCTTTGAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AGAGGCTCCTACCAACGAGGATATGAATATATTGTGAGATTGCACATGTTATGTGAGTTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GAGCATAGCATCAAACCACTTTTCCAGCATTCTCCAGGTGACAGTTCTCAAGAAGATTCT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTAAACTGGGTAGCTCGACTAGAAATGACCCAGAATTCCTACAGAGCCAAGGAGCCTATC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CTGGCTCTCCGGAGGGCTTTACTAAGCCTCAACAAAAGACCAGATTACAATGAAATGGTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GGAGAATGCTGGCTGCAGAGTGCCAGGGTAGCTAGAAAGGCTGGTCACCACCAGACAGCC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TACAATGCTCTCCTTAATGCAGGGGAATCACGACTCGCTGAACTGTACGTGGAAAGGGCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAGTGGCTCTGGTCCAAGGGTGATGTTCACCAGGCACTAATTGTTCTTCAAAAAGGTGTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GAATTATGTTTTCCTGAAAATGAAACCCCACCTGAGGGTAAGAACATGTTAATCCATGGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CGAGCTATGCTACTAGTGGGCCGATTTATGGAAGAAACAGCTAACTTTGAAAGCAATGCA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATTATGAAAAAATATAAGGATGTGACCGCGTGCCTGCCAGAATGGGAGGATGGGCATTTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TACCTTGCCAAGTACTATGACAAATTGATGCCCATGGTCACAGACAACAAAATGGAAAAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAAGGTGATCTCATCCGGTATATAGTTCTTCATTTTGGCAGATCTCTACAATATGGAAAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CAGTTCATATATCAGTCAATGCCACGAATGTTAACTCTATGGCTTGATTATGGTACAAAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCATATGAATGGGAAAAAGCTGGCCGCTCCGATCGTGTACAAATGAGGAATGATTTGGGT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAAATAAACAAGGTTATCACAGAGCATACAAACTATTTAGCTCCATATCAATTTTTGACT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTTTTTCACAATTGATCTCTCGAATTTGTCATTCTCACGATGAAGTTTTTGTTGTCTTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ATGGAAATAATAGCCAAAGTATTTCTAGCCTATCCTCAACAAGCAATGTGGATGATGACA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTGTGTCAAAGTCATCTTATCCCATGCGTGTGAACAGATGCAAGGAAATCCTCAATAAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTATTCATATGAAAAAATCCTTAGAGAAGTTTGTTGGAGATGCAACTCGCCTAACAGAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       AAGCTTCTAGAATTGTGCAATAAACCGGTTGATGGAAGTAGTTCCACATTAAGCATGAGC
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       ACTCATTTTAAAATGCTTAAAAAGCTGGTAGAAGAAGCAACATTTAGTGAAATCCTCATT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CCTCTACAATCAGTCATGATACCTACACTTCCATCAATTCTGGGTACCCATGCTAACCAT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GCTAGCCATGAACCATTTCCTGGACATTGGGCCTATATTGCAGGGTTTGATGATATGGTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GAAATTCTTGCTTCTCTTCAGAAACCAAAGAAGATTTCTTTAAAAGGCTCAGATGGAAAG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTCTACATCATGATGTGTAAGCCAAAAGATGACCTGAGAAAGGATTGTAGACTAATGGAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       TTCAATTCCTTGATTAATAAGTGCTTAAGAAAAGATGCAGAGTCTCGTAGAAGAGAACTT
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CATATTCGAACATATGCAGTTATTCCACTAAATGATGAATGTGGGATTATTGAATGGGTG
                                                                              

HsCD00591014      -------------------------------------CTTTAAGAAGGAGATATACCATG
NM_001184.3       AACAACACTGCTGGTTTGAGACCTATTCTGACCAAACTATATAAAGAAAAGGGAGTGTAT
                                                        :*::*.*...*.. .:.  :: 

HsCD00591014      GGCCATCACCATCACCATCACAGCCATATGCTACCAAAGTCAGCAGCTTTATCTGAAAAA
NM_001184.3       ATGACAGGAAAAGAACTTCGCCAGTGTATGCTACCAAAGTCAGCAGCTTTATCTGAAAAA
                  .  ..: ...*: *.*:**.*..  .**********************************

HsCD00591014      CTCAAAGTATTCCGAGAATTTCTCCTGCCCAGGCATCCTCCTATTTTTCATGAGTGGTTT
NM_001184.3       CTCAAAGTATTCCGAGAATTTCTCCTGCCCAGGCATCCTCCTATTTTTCATGAGTGGTTT
                  ************************************************************

HsCD00591014      CTGAGAACATTCCCTGATCCTACATCATGGTACAGTAGTAGATCAGCTTACTGCCGTTCC
NM_001184.3       CTGAGAACATTCCCTGATCCTACATCATGGTACAGTAGTAGATCAGCTTACTGCCGTTCC
                  ************************************************************

HsCD00591014      ACTGCAGTAATGTCAATGGTTGGTTATATTCTGGGGCTTGGAGACCGTCATGGTGAAAAT
NM_001184.3       ACTGCAGTAATGTCAATGGTTGGTTATATTCTGGGGCTTGGAGACCGTCATGGTGAAAAT
                  ************************************************************

HsCD00591014      ATTCTCTTTGATTCTTTGACTGGTGAATGCGTACATGTAGATTTCAATTGTCTTTTCAAT
NM_001184.3       ATTCTCTTTGATTCTTTGACTGGTGAATGCGTACATGTAGATTTCAATTGTCTTTTCAAT
                  ************************************************************

HsCD00591014      AAGGGAGAAACCTTTGAAGTTCCAGAAATTGTGCCATTTCGCCTGACTCATAATATGGTT
NM_001184.3       AAGGGAGAAACCTTTGAAGTTCCAGAAATTGTGCCATTTCGCCTGACTCATAATATGGTT
                  ************************************************************

HsCD00591014      AATGGAATGGGTCCTATGGGAACAGAGGGTCTTTTTCGAAGAGCATGTGAAGTTACAATG
NM_001184.3       AATGGAATGGGTCCTATGGGAACAGAGGGTCTTTTTCGAAGAGCATGTGAAGTTACAATG
                  ************************************************************

HsCD00591014      AGGCTGATGCGTGATCAGCGAGAGCCTTTAATGAGTGTCTTAAAGACTTTTCTACATGAT
NM_001184.3       AGGCTGATGCGTGATCAGCGAGAGCCTTTAATGAGTGTCTTAAAGACTTTTCTACATGAT
                  ************************************************************

HsCD00591014      CCTCTTGTGGAATGGAGTAAACCAGTGAAAGGGCATTAGCTCGAGATCCGGCTGCT----
NM_001184.3       CCTCTTGTGGAATGGAGTAAACCAGTGAAAGGGCATTCCAAAGCGCCACTGAATGAAACT
                  *************************************. .:.*.*. .* *.:  :    

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GGAGAAGTTGTCAATGAAAAGGCCAAGACCCATGTTCTTGACATTGAGCAGCGACTACAA
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       GGTGTAATCAAGACTCGAAATAGAGTGACAGGACTGCCGTTATCTATTGAAGGACATGTG
                                                                              

HsCD00591014      ------------------------------------------------------------
NM_001184.3       CATTACCTTATACAGGAAGCTACTGATGAAAACTTACTATGCCAGATGTATCTTGGTTGG
                                                                              

HsCD00591014      ---------------
NM_001184.3       ACTCCATATATGTGA
                                 

Pathways

NCI : ATR signaling pathway
NCI : BARD1 signaling events
NCI : Circadian rhythm pathway
NCI : Fanconi anemia pathway
NCI : p53 pathway
NCI : Signaling events mediated by TCPTP
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Repair
Reactome : Fanconi Anemia pathway
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Meiosis
Reactome : Meiotic synapsis
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : miRNA regulation of DNA Damage Response

Protein

SMART domain : PI3Kc : Phosphoinositide 3-kinase, catalytic domain
Structural Annotation Wiki : HR3359K
UniProt : Q13535
HPRD : 08369

Clone

Cloning Information : 628823
Original Clone ID : HR3359K-2411-2572-14.19

Experimental

TargetTrack - Experimental data : HR3359K

Organism


TAX_ID : 9606
Species Specific ID: 545

Genome

Chromosome : 3
Map Location : 3q23
Ensembl : ENSG00000175054

Reagents

Labome : ATR-antibody