DNASU Plasmid Repository • 480.965.5697 | Email

TNFRSF6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FAS
Gene Name:  Fas cell surface death receptor
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH119927.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00005945

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1008nts         Open reading frame : 1 to 1008
Reference Sequence Alignment

ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT
CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA
AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACCTTAAATCCTGAAACAGTG
GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1318
Start on reference sequence 311
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FAS
Symbol Nomenclature : FAS
SYNONYM : ALPS1A; APO-1; APT1; CD95; FAS1; FASTM; TNFRSF6
Designation : APO-1 cell surface antigen|CD95 antigen|Delta Fas/APO-1/CD95|FAS 827dupA|FAS receptor variant 9|FASLG receptor|Fas (TNF receptor superfamily, member 6)|Fas AMA|TNF receptor superfamily member 6|apoptosis antigen 1|apoptosis-mediating surface antigen FAS|tumor necrosis factor receptor superfamily member 6|tumor necrosis factor receptor superfamily, member 6
Full Nomenclature : Fas cell surface death receptor
GENEID : 355
Locus Tag : RP11-399O19.7
GI : 60811995
GenBank Accession : AY893155
HGNC : 11920
MIM : 134637
Vega : OTTHUMG00000018701
Target GenBank: BC012479

 

Reference Sequence Alignment

  

HsCD00005945      ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
NM_000043.4       ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
NM_152871.2       ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC
                  ************************************************************

HsCD00005945      AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
NM_000043.4       AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
NM_152871.2       AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT
                  ************************************************************

HsCD00005945      GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
NM_000043.4       GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
NM_152871.2       GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT
                  ************************************************************

HsCD00005945      AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
NM_000043.4       AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
NM_152871.2       AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA
                  ************************************************************

HsCD00005945      GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
NM_000043.4       GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
NM_152871.2       GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA
                  ************************************************************

HsCD00005945      TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
NM_000043.4       TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
NM_152871.2       TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC
                  ************************************************************

HsCD00005945      CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
NM_000043.4       CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
NM_152871.2       CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT
                  ************************************************************

HsCD00005945      GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
NM_000043.4       GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
NM_152871.2       GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC
                  ************************************************************

HsCD00005945      AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT
NM_000043.4       AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT
NM_152871.2       AGCAACACCAAGTGCAAAGAGGAAG-----------------------------------
                  *************************                                   

HsCD00005945      CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA
NM_000043.4       CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA
NM_152871.2       ----------------------------TGAAGAGAAAGGAAGTACAGAAAACATGCAGA
                                              ********************************

HsCD00005945      AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACCTTAAATCCTGAAACAGTG
NM_000043.4       AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACTTTAAATCCTGAAACAGTG
NM_152871.2       AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACTTTAAATCCTGAAACAGTG
                  ***************************************** ******************

HsCD00005945      GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
NM_000043.4       GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
NM_152871.2       GCAATAAATTTATCTGATGTTGACTTGAGTAAATATATCACCACTATTGCTGGAGTCATG
                  ************************************************************

HsCD00005945      ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
NM_000043.4       ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
NM_152871.2       ACACTAAGTCAAGTTAAAGGCTTTGTTCGAAAGAATGGTGTCAATGAAGCCAAAATAGAT
                  ************************************************************

HsCD00005945      GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
NM_000043.4       GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
NM_152871.2       GAGATCAAGAATGACAATGTCCAAGACACAGCAGAACAGAAAGTTCAACTGCTTCGTAAT
                  ************************************************************

HsCD00005945      TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
NM_000043.4       TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
NM_152871.2       TGGCATCAACTTCATGGAAAGAAAGAAGCGTATGACACATTGATTAAAGATCTCAAAAAA
                  ************************************************************

HsCD00005945      GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
NM_000043.4       GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
NM_152871.2       GCCAATCTTTGTACTCTTGCAGAGAAAATTCAGACTATCATCCTCAAGGACATTACTAGT
                  ************************************************************

HsCD00005945      GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTTG
NM_000043.4       GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTAG
NM_152871.2       GACTCAGAAAATTCAAACTTCAGAAATGAAATCCAAAGCTTGGTCTAG
                  **********************************************:*

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Direct p53 effectors
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : p73 transcription factor network
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Panther : p53 pathway
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : FasL/ CD95L signaling
Reactome : Regulation by c-FLIP
WikiPathway : Adipogenesis
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : MAPK signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 119927
HIP Master Clone ID : 95581
Original Clone ID : FLH119927.01L

Organism


TAX_ID : 9606
Species Specific ID: 355

Genome

Chromosome : 10
Map Location : 10q24.1
Ensembl : ENSG00000026103

Reagents

Labome : Fas-antibody