DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_cHalo-3xHA_DC


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJFT7_cHalo-3xHA_DC              
Source: CPD
Description: In vitro expression vector with a T7 promoter and C-terminal TEV-cleavable HALO-3xHA tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments: None
Publications: None
Authors: Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa

Price:  Login for Pricing
No restriction
Special MTA: HALO



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_cHalo-3xHA_DC

pJFT7_cHalo-3xHA_DC in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  NAP150
Reverse:  cHaloseqR
Description: In vitro expression vector with a T7 promoter and C-terminal TEV-cleavable HALO-3xHA tag; ampicillin resistance; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6301
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 3586 4268
bacterial origin M13 Ori M13 origin 5662 6117
death cassette ccdB ccdB death cassette (removed in plasmids that contain an insert) 1765 2070
enhancer CITE CITE enhancer 17 515
primer NAP150 nap150f forward sequencing primer cccattgtatgggatctgatc 388 408
primer reverse primer cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT 2351 2369
promoter T7 T7 promoter 6277 3
protease cleavage site TEV TEV protease cleavage site (EDLYFQS) 2258 2278
recombination site attR1 attR1 recombination site 531 555
recombination site attR2 attR2 recombinational cloning site 2211 2235
reporter gene LacZ LacZ alpha 6122 6190
selectable marker CmR chloramphenicol resistance (removed in plasmids containing an insert) 764 1420
selectable marker AmpR Ampicillin resistance marker 4366 5025
ssDNA origin f1 f1 origin 5794 6100
tag HALO C-terminal TEV-cleavable HALO-3xHA tag 2294 3178
tag HA C-terminal TEV-cleavable HALO-3xHA tag 3182 3274
trxn termination sequence T7 term T7 terminator 3346 3364


Species Specific ID: None
Target GenBank: None