| Gene: |
Gene Symbol:
No insert Gene Name: No insert |
|---|---|
| Original Clone ID: | None |
| Type: | No insert |
| Vector Name: | pJFT7_n3xFlag-Halo_DC |
| Source: | CPD |
| Description: | In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable 3xFlag-Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible |
| Comments: | None |
| Publications: | None |
| Authors: |
Joshua LaBaer Center for Personalized Diagnostics Arizona State University Ji Qiu Fernanda Festa Justin Saul |
|
EvNO00595407 Price: Login for Pricing AVAILABLE No restriction Special MTA: HALO |
| Distributed in bacterial strain : | DB3.1 T1 phage resistant |
|---|---|
| Antibiotic Selection: |
Host Type:
bacterial
Marker:
ampicillin Bacterial Selection Condition: 100 ug/mL ampicillin Growth Condition: Growth with the single antibiotic in LB at 37 degrees is recommended. Comments: Commonly used conditions for ampicillin resistant plasmid clones. |
Powered by LabGenius |
||
| Vector Name: | pJFT7_n3xFlag-Halo_DC |
pJFT7_n3xFlag-Halo_DC in advanced viewed |
| Synonyms: | None | |
| Sequencing Primer: | Forward:
HaloseqF
Reverse: NAP138R |
|
| Description: | In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable 3xFlag-Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible | |
| Comments: | None | |
| Size (bp): | 6286 | |
| Parent Vector: | None | |
| Properties: | Gateway, acceptor (destination), blue/white selection, in vitro transcription, recombinational cloning | |
| Author Name: |
Joshua LaBaer Center for Personalized Diagnostics Arizona State University Ji Qiu Fernanda Festa Justin Saul |
|
| Publications: | None | |
| Vector Map: |
Vector Sequence:
|
|
| Sequence: |
Vector Features:
| Type | Name | Description | Start Position | End Position |
|---|---|---|---|---|
| bacterial origin | M13 Ori | M13 origin | 5647 | 6102 |
| bacterial origin | ColE | ColE1 bacterial origin | 3571 | 4253 |
| death cassette | ccdB | Gateway ccdB death Cassette (DC) (removed in plasmids with inserts) | 1558 | 3212 |
| death cassette 2 | ccdB (BsrGI removed) | ccdb(bsrgi removed) | 2767 | 3072 |
| enhancer | CITE | CITE enhancer | 17 | 515 |
| primer | forward primer | HaloseqF aagcctgcctaactgcaa (used for sequencing the gene insert) | 1364 | 1381 |
| primer | NAP150 | NAP150F forward sequencing primer cccattgtatgggatctgatc (sequencing starts before the 3xFlag-HALO tag) | 338 | 408 |
| primer | reverse primer | cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT | 657 | 675 |
| primer | M13 forward | M13 forward sequencing primer | 6246 | 6263 |
| primer | T7 term primer | T7 terminator primer | 3331 | 3349 |
| primer | NAP138 | NAP138r reverse sequencing primer tgtttcgccatttatcacctt | 3272 | 3292 |
| promoter | T7 | T7 promoter | 6270 | 6286 |
| protease cleavage site | TEV | TEV protease cleavage site EDLYFQS (used to separate expressed protein from 3xFlag-HALO tag) | 1497 | 1517 |
| recombination site | attR2 | attR2 recombinational cloning site | 3213 | 3237 |
| recombination site | attR1 | attR1 recombinational cloning site | 1533 | 1557 |
| reporter gene | LacZ | LacZ alpha | 6107 | 6175 |
| selectable marker | AmpR | Ampicillin resistance gene | 4351 | 5010 |
| selectable marker | CmR | Chloramphenicol resistance gene (removed in plasmids containing gene inserts) | 1766 | 2422 |
| ssDNA origin | f1 | f1 origin | 5779 | 6085 |
| tag | HALO | N-terminal HALO tag | 597 | 1484 |
| tag | Flag | N-terminal 3xFlag tag | 546 | 590 |
| trxn termination sequence | T7 term | T7 terminator | 3342 | 3389 |
| Species Specific ID: | None |
|---|---|
| Target GenBank: | None |
