DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_cHalo-3xFlag_DC

TOP

Explanation of Terms


Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJFT7_cHalo-3xFlag_DC              
Source: CPD
Description: In vitro expression vector with a T7 promoter and C-terminal TEV-cleavable HALO-3xFlag tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Publications: None
Authors: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
EvNO00595408

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: HALO

 

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_cHalo-3xFlag_DC

pJFT7_cHalo-3xFlag_DC in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  NAP150
Reverse:  cHaloseqR
Description: In vitro expression vector with a T7 promoter and C-terminal TEV-cleavable HALO-3xFlag tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6274
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning
Author Name: Joshua LaBaer
Center for Personalized Diagnostics
Arizona State University
Ji Qiu
Fernanda Festa
Justin Saul
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin M13 Ori M13 origin 5365 6090
bacterial origin ColE ColE1 bacterial origin 3559 4241
death cassette ccdB Gateway ccdB death Cassette (DC) (removed in plasmids with inserts) 556 2210
death cassette 2 ccdB (BsrGI removed) ccdB (BsrGI removed) 1765 2070
enhancer CITE CITE enhancer 388 408
primer NAP150 NAP150F forward sequencing primer cccattgtatgggatctgatc (sequencing starts before the 3xFlag-HALO tag) 388 408
primer reverse primer cHaloseqR reverse sequencing primer CAACATCGACGTAGTGCAT (used for sequencing the gene insert) 2351 2369
promoter T7 T7 promoter 6250 3
protease cleavage site TEV TEV protease cleavage site EDLYFQS (removes C-terminal HALO 3xFlag tag) 2258 2278
recombination site attR2 attR2 recombination site 2211 2235
recombination site attR1 attR1 recombination site 531 555
reporter gene LacZ LacZ alpha gene 6095 6163
selectable marker CmR Chloramphenicol resistance gene (removed in plasmids containing gene inserts) 764 1420
selectable marker AmpR ampicillin resistance gene 4339 4998
ssDNA origin f1 f1 origin 5767 6073
tag Flag C-terminal 3xFlag tag 3179 3247
tag HALO C-terminal Halo tag 2294 3178
trxn termination sequence T7 term T7 transcription terminator 3319 3337

 

Species Specific ID: None
Target GenBank: None