DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Vector Information: pJFT7_n3xHA-Halo_DC


Explanation of Terms

Gene: Gene Symbol:  No insert
Gene Name:  No insert
Original Clone ID: None
Type: No insert
Vector Name: pJFT7_n3xHA-Halo_DC              
Source: CPD
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable 3xHA-Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Publications: None
Authors: Arizona State University
Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Center for Personalized Diagnostics

Price:  Login for Pricing
No restriction
Special MTA: HALO



 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJFT7_n3xHA-Halo_DC

pJFT7_n3xHA-Halo_DC in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  HaloseqF
Reverse:  NAP138R
Description: In vitro expression vector with a T7 promoter and N-terminal TEV-cleavable 3xHA-Halo tag; ampicillin resistance in bacteria; Gateway or Flexi cloning compatible
Comments: None
Size (bp): 6313
Parent Vector: None
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning
Author Name: Arizona State University
Joshua LaBaer
Justin Saul
Ji Qiu
Fernanda Festa
Center for Personalized Diagnostics
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin M13 Ori M13 origin 5674 6129
bacterial origin ColE ColE1 origin 3598 4280
death cassette ccdB Gateway ccdB death Cassette (DC) (removed in plasmids with inserts) 1585 3239
death cassette 2 ccdB (BsrGI removed) ccdB (bsrgi removed) 2794 3099
enhancer CITE CITE enhancer 17 515
primer M13 forward M13 forward sequencing primer 6273 6290
primer forward primer HaloseqF aagcctgcctaactgcaa (used for sequencing the gene insert) 1391 1408
primer T7 reverse T7 term primer (can be used to sequence the insert) 3358 3376
primer NAP138 NAP138r reverse sequencing primer tgtttcgccatttatcacctt (can be used to sequence the gene insert) 3299 3319
promoter T7 T7 promoter 6297 6313
protease cleavage site TEV TEV protease cleavage site EDLYFQS (used to separate expressed protein from 3xHA-HALO tag) 1524 1544
recombination site attR2 attR2 recombination site 3240 3264
recombination site attR1 attR1 recombination site 1560 1584
reporter gene LacZ LacZ alpha 6134 6202
selectable marker AmpR ampicillin resistance gene 4378 5037
selectable marker CmR Chloramphenicol resistance gene (removed in plasmids containing gene inserts) 1793 2449
ssDNA origin f1 f1 origin 5806 6112
tag HALO N-terminal HALO tag 624 1511
tag HA N-terminal 3xHA tag 525 617
trxn termination sequence T7 term T7 terminator 3369 3416


Species Specific ID: None
Target GenBank: None