DNASU Plasmid Repository • 480.965.5697 | Email

SFN (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SFN
Gene Name:  stratifin
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130877.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00005964

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 747nts         Open reading frame : 1 to 747
Reference Sequence Alignment

ATGGAGAGAGCCAGTCTGATCCAGAAGGCCAAGCTGGCAGAGCAGGCCGAACGCTATGAG
GACATGGCAGCCTTCATGAAAGGCGCCGTGGAGAAGGGCGAGGAGCTCTCCTGCGAAGAG
CGAAACCTGCTCTCAGTAGCCTATAAGAACGTGGTGGGCGGCCAGAGGGCTGCCTGGAGG
GTGCTGTCCAGTATTGAGCAGAAAAGCAACGAGGAGGGCTCGGAGGAGAAGGGGCCCGAG
GTGCGTGAGTACCGGGAGAAGGTGGAGACTGAGCTCCAGGGCGTGTGCGACACCGTGCTG
GGCCTGCTGGACAGCCACCTCATCAAGGAGGCCGGGGACGCCGAGAGCCGGGTCTTCTAC
CTGAAGATGAAGGGTGACTACTACCGCTACCTGGCCGAGGTGGCCACCGGTGACGACAAG
AAGCGCATCATTGACTCAGCCCGGTCAGCCTACCAGGAGGCCATGGACATCAGCAAGAAG
GAGATGCCGCCCACCAACCCCATCCGCCTGGGCCTGGCCCTGAACTTTTCCGTCTTCCAC
TACGAGATCGCCAACAGCCCCGAGGAGGCCATCTCTCTGGCCAAGACCACTTTCGACGAG
GCCATGGCTGATCTGCACACCCTCAGCGAGGACTCCTACAAAGACAGCACCCTCATCATG
CAGCTGCTGCGAGACAACCTGACACTGTGGACGGCCGACAACGCCGGGGAAGAGGGGGGC
GAGGCTCCCCAGGAGCCCCAGAGCGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 795
Start on reference sequence 49
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SFN
Symbol Nomenclature : SFN
SYNONYM : YWHAS
Designation : 14-3-3 protein sigma|14-3-3 sigma|epithelial cell marker protein 1
Full Nomenclature : stratifin
GENEID : 2810
GI : 60835713
GenBank Accession : AY894114
HGNC : 10773
MIM : 601290
Vega : OTTHUMG00000004093
Target GenBank: BC000995

 

Reference Sequence Alignment

  

HsCD00005964      ATGGAGAGAGCCAGTCTGATCCAGAAGGCCAAGCTGGCAGAGCAGGCCGAACGCTATGAG
NM_006142.3       ATGGAGAGAGCCAGTCTGATCCAGAAGGCCAAGCTGGCAGAGCAGGCCGAACGCTATGAG
                  ************************************************************

HsCD00005964      GACATGGCAGCCTTCATGAAAGGCGCCGTGGAGAAGGGCGAGGAGCTCTCCTGCGAAGAG
NM_006142.3       GACATGGCAGCCTTCATGAAAGGCGCCGTGGAGAAGGGCGAGGAGCTCTCCTGCGAAGAG
                  ************************************************************

HsCD00005964      CGAAACCTGCTCTCAGTAGCCTATAAGAACGTGGTGGGCGGCCAGAGGGCTGCCTGGAGG
NM_006142.3       CGAAACCTGCTCTCAGTAGCCTATAAGAACGTGGTGGGCGGCCAGAGGGCTGCCTGGAGG
                  ************************************************************

HsCD00005964      GTGCTGTCCAGTATTGAGCAGAAAAGCAACGAGGAGGGCTCGGAGGAGAAGGGGCCCGAG
NM_006142.3       GTGCTGTCCAGTATTGAGCAGAAAAGCAACGAGGAGGGCTCGGAGGAGAAGGGGCCCGAG
                  ************************************************************

HsCD00005964      GTGCGTGAGTACCGGGAGAAGGTGGAGACTGAGCTCCAGGGCGTGTGCGACACCGTGCTG
NM_006142.3       GTGCGTGAGTACCGGGAGAAGGTGGAGACTGAGCTCCAGGGCGTGTGCGACACCGTGCTG
                  ************************************************************

HsCD00005964      GGCCTGCTGGACAGCCACCTCATCAAGGAGGCCGGGGACGCCGAGAGCCGGGTCTTCTAC
NM_006142.3       GGCCTGCTGGACAGCCACCTCATCAAGGAGGCCGGGGACGCCGAGAGCCGGGTCTTCTAC
                  ************************************************************

HsCD00005964      CTGAAGATGAAGGGTGACTACTACCGCTACCTGGCCGAGGTGGCCACCGGTGACGACAAG
NM_006142.3       CTGAAGATGAAGGGTGACTACTACCGCTACCTGGCCGAGGTGGCCACCGGTGACGACAAG
                  ************************************************************

HsCD00005964      AAGCGCATCATTGACTCAGCCCGGTCAGCCTACCAGGAGGCCATGGACATCAGCAAGAAG
NM_006142.3       AAGCGCATCATTGACTCAGCCCGGTCAGCCTACCAGGAGGCCATGGACATCAGCAAGAAG
                  ************************************************************

HsCD00005964      GAGATGCCGCCCACCAACCCCATCCGCCTGGGCCTGGCCCTGAACTTTTCCGTCTTCCAC
NM_006142.3       GAGATGCCGCCCACCAACCCCATCCGCCTGGGCCTGGCCCTGAACTTTTCCGTCTTCCAC
                  ************************************************************

HsCD00005964      TACGAGATCGCCAACAGCCCCGAGGAGGCCATCTCTCTGGCCAAGACCACTTTCGACGAG
NM_006142.3       TACGAGATCGCCAACAGCCCCGAGGAGGCCATCTCTCTGGCCAAGACCACTTTCGACGAG
                  ************************************************************

HsCD00005964      GCCATGGCTGATCTGCACACCCTCAGCGAGGACTCCTACAAAGACAGCACCCTCATCATG
NM_006142.3       GCCATGGCTGATCTGCACACCCTCAGCGAGGACTCCTACAAAGACAGCACCCTCATCATG
                  ************************************************************

HsCD00005964      CAGCTGCTGCGAGACAACCTGACACTGTGGACGGCCGACAACGCCGGGGAAGAGGGGGGC
NM_006142.3       CAGCTGCTGCGAGACAACCTGACACTGTGGACGGCCGACAACGCCGGGGAAGAGGGGGGC
                  ************************************************************

HsCD00005964      GAGGCTCCCCAGGAGCCCCAGAGCGAC
NM_006142.3       GAGGCTCCCCAGGAGCCCCAGAGCTGA
                  ************************ ..

Pathways

NCI : Class I PI3K signaling events mediated by Akt
NCI : Direct p53 effectors
NCI : ErbB1 downstream signaling
NCI : FoxO family signaling
NCI : Glucocorticoid receptor regulatory network
NCI : Insulin-mediated glucose transport
NCI : LKB1 signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of nuclear beta catenin signaling and target gene transcription
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : a6b1 and a6b4 Integrin signaling
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
NCI : p73 transcription factor network
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Parkinson disease
Panther : p53 pathway
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Apoptosis
Reactome : Intrinsic Pathway for Apoptosis
Reactome : Membrane Trafficking
Reactome : Translocation of GLUT4 to the plasma membrane
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : DNA damage response
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : miRNA regulation of DNA Damage Response

Protein

SMART domain : 14_3_3 : 14-3-3 homologues
UniProt : P31947
HPRD : 03185

Clone

Cloning Information : 130877
HIP Master Clone ID : 107034
Original Clone ID : FLH130877.01L

Organism


TAX_ID : 9606
Species Specific ID: 2810

Genome

Chromosome : 1
Map Location : 1p36.11
Ensembl : ENSG00000175793

Reagents

Labome : stratifin-antibody